View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7420_low_8 (Length: 239)
Name: NF7420_low_8
Description: NF7420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7420_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 33 - 222
Target Start/End: Original strand, 55143669 - 55143858
Alignment:
| Q |
33 |
tagcaattgttagcgttggcttgttgattttacttgcacgatttaattatcgagttttaatagtcagctatacttatttgatgtcgactatcttcatttt |
132 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55143669 |
tagcaattgttagtgttggcttgttgattttacttgcacgatttaattatcgagttttaatagtcagctatacttatttgatgtcgactatcttcatttt |
55143768 |
T |
|
| Q |
133 |
taataatattgatgcgtttacttgatgacacatcgaccattatttccattcatacgtgcagaatcatttcaaatatcatcttccggaata |
222 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||| ||||||||||| ||| ||| |||| ||||||||||||||| |||||| |
|
|
| T |
55143769 |
taataatattgatgtgtttacttgatgacacgtcgaccattacttccattcataggtgtagactcatctcaaatatcatcttcaggaata |
55143858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University