View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7423_low_3 (Length: 224)
Name: NF7423_low_3
Description: NF7423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7423_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 33 - 208
Target Start/End: Original strand, 49910181 - 49910356
Alignment:
| Q |
33 |
agggcccgtttggtggccaagattaggagattatcatatcctactcaagtctattgtttgatgcacctataggatatgataaactaaccatatcactaat |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49910181 |
agggcccgtttggtggccaagattaggagattatcatatcctactcaagtctattgtttgatgcacctataggatatgataaactaaccatatcattaat |
49910280 |
T |
 |
| Q |
133 |
tctatcttatttgtcttgcgttgctcttcctctctagtcgtctcgcatttgcaaccattgtgtctctccatctaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49910281 |
tctatcttatttgtcttgcgttgctcttcctctctagtcgtctcgcgtttgcaaccattgtgtctctccatctaat |
49910356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University