View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7424_high_13 (Length: 248)
Name: NF7424_high_13
Description: NF7424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7424_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 43102945 - 43103179
Alignment:
| Q |
1 |
aacgagagtagaaaataagagctgttatggctattggaaaagcaagcatcattagggatttcatttcttccatgatggttgaaaaggaacatgtatttgg |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102945 |
aacgagaatagaaaataagagctgttatggctattggaaaagcaagcatcattagggatttcatttcttccatgatggttgaaaaggaacatgtatttgg |
43103044 |
T |
|
| Q |
101 |
tttggtgtagtcacttaccaaatgcacttgctccatgattatgtttgtcttgttaggggaagaagac-aatatgattttaaatggaggtggtggatggtg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43103045 |
tttggtgtagtcacttaccaaatgcacttgctccatgattatgtttgtcttgttaggggaagaagacaaatatgattttaaatggaggtggtggatggtg |
43103144 |
T |
|
| Q |
200 |
aatgggtttttggttgtagaaggacagtgaaactg |
234 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43103145 |
aatgggtttttggttgtagaaggaccgtgaaactg |
43103179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University