View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7424_low_19 (Length: 220)
Name: NF7424_low_19
Description: NF7424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7424_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 42088303 - 42088124
Alignment:
| Q |
17 |
cagagacgtgtggcatgaacgtgacaactcgtgacaagtaaagagttccttctacaaatgaaatagatagggccattagatgtcctacaacaagtaaact |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42088303 |
cagagacgtgtggcatgaacgtgacaactcgtgacaagtaaagagttccttctacaaatgaaatagataaggccattagatgtcctacaacaagtaaact |
42088204 |
T |
|
| Q |
117 |
aacaaagataatttcttgagtgcttcttttccaactctatgagcttctcgtgtgttttatgcagtttaggttatataatc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
42088203 |
aacaaagataatttcttgagtgcttcttttccaactctatgagtttctcgtgtgtcttatgcagttcaggttatataatc |
42088124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University