View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7425_high_12 (Length: 325)
Name: NF7425_high_12
Description: NF7425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7425_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 51; Significance: 3e-20; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 130 - 180
Target Start/End: Original strand, 5030748 - 5030798
Alignment:
| Q |
130 |
cttcagcgtttcacgtggcataaattgattgaatcatgtggtacttcgtta |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5030748 |
cttcagcgtttcacgtggcataaattgattgaatcatgtggtacttcgtta |
5030798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 16 - 58
Target Start/End: Original strand, 5030633 - 5030675
Alignment:
| Q |
16 |
atttacattgggaggggagagatgacattctaggttgttcaag |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5030633 |
atttacattgggaggggagagatgacattctaggttgttcaag |
5030675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 267 - 308
Target Start/End: Complemental strand, 4971263 - 4971222
Alignment:
| Q |
267 |
gcataaccttaaacgacatttgatatgaaacttatggagtaa |
308 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
4971263 |
gcataaccttaaacgacatttaatatgagacttatggagtaa |
4971222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University