View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7425_high_22 (Length: 236)

Name: NF7425_high_22
Description: NF7425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7425_high_22
NF7425_high_22
[»] chr5 (1 HSPs)
chr5 (1-184)||(11418342-11418525)


Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 11418342 - 11418525
Alignment:
1 gattggtagctagagcaccttctttgcatggagggaagaggaaatcatgcaaatcaagatggaaattggaagctgaatcatgtacaaaatgagtgttagt 100  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11418342 gattggtagctagagcaccttctttgcatggagggaagtggaaatcatgcaaatcaagatggaaattggaagctgaatcatgtacaaaatgagtgttagt 11418441  T
101 tgtaactccaggggatgggaagagaatgggcatgtcgaatgttctttcactcttccaaccacataacattaaacagttacacct 184  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||    
11418442 tgtaactcgaggggatgggaagagaatgggcatgtcgaatgttctttcactcttccaaccacgtaagatttaacagttacacct 11418525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University