View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7425_low_20 (Length: 252)
Name: NF7425_low_20
Description: NF7425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7425_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 36 - 234
Target Start/End: Complemental strand, 33200345 - 33200147
Alignment:
| Q |
36 |
tagaaagtctttatttatagcgaaaaactcatctactgattatctcttttaagcaaaatgggactttaacacgtagaaatgataatgatatcatgttatg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33200345 |
tagaaagtctttatttatagcgaaaaactcatccactgattatctcttttaagcaaaatgggactttaacacgtagaaatgataataatatcatgttatg |
33200246 |
T |
|
| Q |
136 |
gtcttgacgattgttagttaaatataaatgtgcatggtagcaaacaataacgacccttatcacattaatatgaagaaattgaaaagtaacaccccacgt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33200245 |
gtcttgacgattgttagttaaatataaatgtgcatggtaacaaacaataacgacccttatcacattaatatgaagaaattgaaaagtaacaccccacgt |
33200147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 33200413 - 33200377
Alignment:
| Q |
1 |
ctaaagtctttttattttctttgttgataaatatcta |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33200413 |
ctaaagtctttttattttctttgttgataaatatcta |
33200377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 178 - 215
Target Start/End: Original strand, 44770856 - 44770893
Alignment:
| Q |
178 |
aacaataacgacccttatcacattaatatgaagaaatt |
215 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44770856 |
aacaataacgacacttatcacattaatatgaagaaatt |
44770893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University