View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7425_low_25 (Length: 236)
Name: NF7425_low_25
Description: NF7425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7425_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 11418342 - 11418525
Alignment:
| Q |
1 |
gattggtagctagagcaccttctttgcatggagggaagaggaaatcatgcaaatcaagatggaaattggaagctgaatcatgtacaaaatgagtgttagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11418342 |
gattggtagctagagcaccttctttgcatggagggaagtggaaatcatgcaaatcaagatggaaattggaagctgaatcatgtacaaaatgagtgttagt |
11418441 |
T |
 |
| Q |
101 |
tgtaactccaggggatgggaagagaatgggcatgtcgaatgttctttcactcttccaaccacataacattaaacagttacacct |
184 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
11418442 |
tgtaactcgaggggatgggaagagaatgggcatgtcgaatgttctttcactcttccaaccacgtaagatttaacagttacacct |
11418525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University