View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7426_high_10 (Length: 243)
Name: NF7426_high_10
Description: NF7426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7426_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 32534443 - 32534235
Alignment:
| Q |
19 |
aatactacagtatttttatcaaacaattgtgctatcccagtactattgatactgaaattcaagcatgattgaattgtgtaggttagaaggatccaatata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32534443 |
aatactacagtatttttatcaaacaattgtgctatcccagtactattgatactgaaattcaagcatgattgaattgtgtaggttagaaggatccaatata |
32534344 |
T |
 |
| Q |
119 |
atatttgctagctattttggagtgtctaggctgttagtcatgcccttatttgcgagggttactagtccctgttggttaatgaatgttaactcaagccttt |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32534343 |
atatttgctagctgttttggagtgtctaggctgttagtcatgcccttatttgtgagggttactagtccctgttggttaatgaatgttaactcaagccttt |
32534244 |
T |
 |
| Q |
219 |
agacttcat |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
32534243 |
agacttcat |
32534235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 227
Target Start/End: Complemental strand, 32549534 - 32549447
Alignment:
| Q |
140 |
gtgtctaggctgttagtcatgcccttatttgcgagggttactagtccctgttggttaatgaatgttaactcaagcctttagacttcat |
227 |
Q |
| |
|
||||||||||||||||| ||||||| ||| || | | | | |||| |||||| ||||||||||||||||||| ||||||| ||||| |
|
|
| T |
32549534 |
gtgtctaggctgttagtagtgccctttattgtgacgctcatttgtccttgttggctaatgaatgttaactcaagtctttagatttcat |
32549447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University