View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7427_high_18 (Length: 308)
Name: NF7427_high_18
Description: NF7427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7427_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 9 - 291
Target Start/End: Original strand, 32490097 - 32490378
Alignment:
| Q |
9 |
agcagagaggtgcaatggaagagctttgattacaatttttcctaacattatgatattatttctctgatatttttcctctcattgaagcttggattggctg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32490097 |
agcagagaggtgcaatggaagagctttgattacaatttttcctaagattatgatattatttctctcatatttttcctctcattgaagcttggattggctg |
32490196 |
T |
 |
| Q |
109 |
tcataatataggtcaaccaaatgatttcacatggtgtagtagattatagatatgctcaatgtagactactttacttcatgtgatgggagacttttcgtcc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||| |
|
|
| T |
32490197 |
tcataatataggtcaaccaaatgatttcacatggtgtagtagattatagatatgctcaatgtagactactttaattcatgtgatggtagac-tttcgtcc |
32490295 |
T |
 |
| Q |
209 |
tacgtttcttcaacataatcacgttcatcttgtttcttgtaccttagtttcatacttcaaacataaaataatttctttataac |
291 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32490296 |
tacgtttcttcaacataatcaagttcatcttgtttcttgtaccttagtttcatacttcaaacataaaataatttctttataac |
32490378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University