View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7427_high_29 (Length: 248)
Name: NF7427_high_29
Description: NF7427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7427_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 230
Target Start/End: Original strand, 37445337 - 37445556
Alignment:
| Q |
10 |
cctaaaaaatattacgttgcattgcaagannnnnnnnccttgtttgtagtactagatttttcttaagaattccagtgtcttttcaactgcaaaattttca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37445337 |
cctaaaaaatattacgttgcattgcaagattttttt-ccttgtttgtagtactagatttttcttaagaattccagtgtcttttcaactgcaaaattttca |
37445435 |
T |
|
| Q |
110 |
acatccaagaatcatgtacttaggagtcaaagagctcaatgcattaagtaaagctagtttcgttgaagtactagcataggtgggtgggagttatatgtaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37445436 |
acatccaagaatcatgtacttaggagtcaaagagctcaatgcattaagtaaagctagtttcgttgaagtactagcataggtgggtgggagttatatgtaa |
37445535 |
T |
|
| Q |
210 |
aaatgcattaactaccgaact |
230 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37445536 |
aaatgcattaactaccgaact |
37445556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University