View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7427_high_30 (Length: 242)
Name: NF7427_high_30
Description: NF7427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7427_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 28499401 - 28499191
Alignment:
| Q |
18 |
cacgtatgaatatgaattctctgcctccatgagaccctgcaattgtagtcatgaatat-aatcattaggtaacgagcccaaattgatttcagacaagtag |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28499401 |
cacgtatgaatatgaattttctgcctccatgagaccctgcaactgt-gtcatgaatattaatcattaggtaacgagtccaaattgatttcagacaagtag |
28499303 |
T |
 |
| Q |
117 |
aatttattttgatagagctagatattctccaatagaattaattttgcatatagaattagtgtatatacttatattcaaattcaatttgacaaaataacag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| || |
|
|
| T |
28499302 |
aatttattttgatagagctagatattctccaatagaattaattttgcatatagaattagtgtatatacttatattcaaattcaatttaataaaataagag |
28499203 |
T |
 |
| Q |
217 |
tgacaccacgat |
228 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28499202 |
tgacaccacgat |
28499191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University