View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7427_high_34 (Length: 227)
Name: NF7427_high_34
Description: NF7427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7427_high_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 3240097 - 3239889
Alignment:
| Q |
1 |
atgcttagaaaaaccgccaagccattcaccctcactcccccgtttgatacccccacaacccactctgctatcttcttttcgtgctccgtcggagttgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| || ||||||| | |||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3240097 |
atgcttagaaaaaccgccaagccattgaccctcactcccc-gtatgatacctcaacaacccactatgccatcttcttttcgtgctccgtcggagttgatt |
3239999 |
T |
|
| Q |
101 |
ttaacccaccccgccggggggcacttccagctcacaattgtcataacttttggagtttcttgaacgatcttagtggctttatcagcagcatgatatgcgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3239998 |
ttaacccaccccgccggggggcacttccagctcacaattgtcataacttttggagtttcttgaacgatcttagtggctttatcagcaacatgatatgcgt |
3239899 |
T |
|
| Q |
201 |
taacataact |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
3239898 |
taacataact |
3239889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University