View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7427_high_37 (Length: 217)
Name: NF7427_high_37
Description: NF7427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7427_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 23 - 167
Target Start/End: Complemental strand, 7812175 - 7812031
Alignment:
| Q |
23 |
agtgaccatgtgaattgaaatgtgtaatttgttgaattcgcttagcaattggttgtgacttatttatactctcaaaatctgaatttttatgactaaaata |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7812175 |
agtgaccatgtgaattgaaatgtgtaattttttgaattcgcttagcaattggtcgtgacttatttatactctcaaaatctcaatttttatgactaaaata |
7812076 |
T |
 |
| Q |
123 |
actgtaccatatatatgtatgttttcatgtcttcatttagtgata |
167 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7812075 |
actgtaacatatatatgtatgttttcatgtcttcatttagtgata |
7812031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University