View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7427_low_13 (Length: 371)
Name: NF7427_low_13
Description: NF7427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7427_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 1 - 347
Target Start/End: Complemental strand, 2579784 - 2579438
Alignment:
| Q |
1 |
gaaaggaattcaccatcaacttcaaaatcgggagtaattttattctcattacttttagtaagactttcattggtggtgactataataatattcacattaa |
100 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||| | ||||||||||||||||| |
|
|
| T |
2579784 |
gaaagtaattcaccgtcaacttcaaaatcgggagtaattttattctcattattttgagtaagactttcattggtggggaccaaaataatattcacattaa |
2579685 |
T |
 |
| Q |
101 |
cactatattctatttgtgaagcttgatttgaggttaacatggttccttgcaaagcaagtccatttgctactccaattgtgagcaagtatccaccaggaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
2579684 |
cactatattctatttgtgaagcttgatttgaggttaacatggttccttgcaaagcaagtccatttccaactccaattgtgagcaagtatccaccaggaaa |
2579585 |
T |
 |
| Q |
201 |
gtatccattaatgacaccactgaatcgcatcattttcttgatttcgtcatatggattcctaggggaaattacaggtgaatattttattttgggttcttgt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2579584 |
ttatccattaatgacaccactgaatcgcatcattttctagatttcgtcatatggattcctaggggaaattacaggtgaatattttattttgggttcttgt |
2579485 |
T |
 |
| Q |
301 |
ataacacttatcagtttagactaattttctttgttttatgatcgttg |
347 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2579484 |
ataacacttatcagtttagactaatttcctttgttttatgatcgttg |
2579438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University