View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7427_low_18 (Length: 349)
Name: NF7427_low_18
Description: NF7427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7427_low_18 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 13 - 349
Target Start/End: Complemental strand, 35697437 - 35697101
Alignment:
| Q |
13 |
aatataagacgattcataagttagttcagagtcagcaacacgaggcttattagtgctaccactcttcttatggttaccccctccacaagttattgaaatc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
35697437 |
aatataagacgattcataagttagttcagagtcagcaacacgaggtttattagtgctaccactcttcttatggttaccccctccgcaagttatcgaaatc |
35697338 |
T |
|
| Q |
113 |
tcacaccctaatgctgttccaaagcacgaaaacaaaccgctaccttgccttcgatgcttacctttacctttccctttcgtttgtttcccagttttcttca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35697337 |
tcacaccctaatgctgttccaaagcacgaaaacaaaccgctaccttgccttcgattcttacctttacctttccctttcgtttgtttcccagttttcttca |
35697238 |
T |
|
| Q |
213 |
cactatcattattattattccccaaatgatcataaccctgcggtatatctatctgtctcccccggtccatcttcgtgttcaacatctccccgccattgtc |
312 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35697237 |
cactaccattattattattccccaaatgatcataaacctgcggtatatctatctgtctccaccggtccatcttcgtgttcaacatctccccgccattgtc |
35697138 |
T |
|
| Q |
313 |
cttctccggcggccatttctcaaacattgaattattc |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35697137 |
cttctccggcggccatttctcaaacattgaattattc |
35697101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University