View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7427_low_27 (Length: 250)
Name: NF7427_low_27
Description: NF7427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7427_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 34671893 - 34672008
Alignment:
| Q |
1 |
agtgcgagaacttagtgggctggtaacgtcttttgttttagaggatgttgaggaggatatgtgggtttggcagctaatttcttccaaatgttattaatta |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34671893 |
agtgcgagaatttagtgggctggtaacgtcttttgttttacaggatgttgaggaggatatgtgggtttggcagctaatttcttccaaatgttattagtta |
34671992 |
T |
 |
| Q |
101 |
atttcttccaaacgtt |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34671993 |
atttcttccaaacgtt |
34672008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 137 - 224
Target Start/End: Original strand, 34671996 - 34672097
Alignment:
| Q |
137 |
tcttccaaatgttatttagtgagcaaatcgctactcgacatatgcggacct--------------gacattagttacattgtttgattaaagacaattcc |
222 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
34671996 |
tcttccaaacgttatttagtgagcaaatcgctactcgacatatgcggaccttaatatcaactttggacattagttacattgtttggttaaagacaattcc |
34672095 |
T |
 |
| Q |
223 |
gt |
224 |
Q |
| |
|
|| |
|
|
| T |
34672096 |
gt |
34672097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University