View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7427_low_32 (Length: 239)
Name: NF7427_low_32
Description: NF7427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7427_low_32 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 4329462 - 4329282
Alignment:
| Q |
18 |
gatagacttacaattttaactactacaatgttggttactcatttttatttggtagagaacaaattaaagttgttcattttttgtgggcaaaaccaagaaa |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4329462 |
gatagacttacaattttaattactacaatgttggttactcatttttatttggtagagaacaaattaaagttgttcattttttgtgggcaaaaccaagaaa |
4329363 |
T |
|
| Q |
118 |
tattagcaataattttgctctaattcagctagttattgtctcttaagagtttaagttaaatttcacatggactatgaaagc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4329362 |
tattagcaataattttgctctaattcagctagttattgtctcttaagagtttaagttaaatttcacatggactatgaaagc |
4329282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 204 - 239
Target Start/End: Complemental strand, 4329231 - 4329196
Alignment:
| Q |
204 |
tcatctataaagttcttctttgttaatgtacttttt |
239 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4329231 |
tcatctataaggttcttctttgttaatgtacttttt |
4329196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University