View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7428_high_30 (Length: 218)

Name: NF7428_high_30
Description: NF7428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7428_high_30
NF7428_high_30
[»] chr3 (1 HSPs)
chr3 (1-218)||(38703919-38704136)


Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 38703919 - 38704136
Alignment:
1 cacgttcagtaaattaacttttctagcatcccgccatgatttttgtgaagcaccaaatttgcaggattaggtaaacccgtggtatgatttttgtgatgca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38703919 cacgttcagtaaattaacttttctagcatcccgccatgatttttgtgaagcaccaaatttgcaggattaggtaaacccgtggtatgatttttgtgatgca 38704018  T
101 ccaacaccacatgctaaagctttttgggcaccctttcaattttgatatctttttgctttatttctctaatttctttctagattatagtttcagttatcaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
38704019 ccaacaccacatgctaaagctttttgggcaccctttcaattttgatatcattttgctttatttctctaatttctttctagattatagtttcagttatcaa 38704118  T
201 acaaggttagcattcaca 218  Q
    ||||||||||||||||||    
38704119 acaaggttagcattcaca 38704136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University