View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7428_high_31 (Length: 217)
Name: NF7428_high_31
Description: NF7428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7428_high_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 25 - 199
Target Start/End: Original strand, 26424804 - 26424979
Alignment:
| Q |
25 |
taaagaaccataaactcaaacataagcttctaataaagatatgaatcaatttaataagtttcaagaataaattttggggtggtgtttaacttttgtatcg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26424804 |
taaagaaccataaactcaaacataagcttctaataaggatatgaatcaatttaataagtttcaagaataaattttggggtggtgtttaacttttgtatcg |
26424903 |
T |
 |
| Q |
125 |
agtggctcccctcctagtcttattgctctagtt-annnnnnnnagttctggtgttccttcatttaaggcctttcat |
199 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26424904 |
agtggctcccctcctagtcttattgctttagttctttttttttagttctggtgttccttcatttaaggcctttcat |
26424979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 52 - 81
Target Start/End: Original strand, 6652894 - 6652923
Alignment:
| Q |
52 |
ttctaataaagatatgaatcaatttaataa |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6652894 |
ttctaataaagatatgaatcaatttaataa |
6652923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University