View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7428_high_33 (Length: 214)
Name: NF7428_high_33
Description: NF7428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7428_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 20 - 195
Target Start/End: Complemental strand, 33184348 - 33184173
Alignment:
| Q |
20 |
atgattcgtttctatagagatatgagtgaaactcatatcatcacaataagggagcttctaagattcatgctcactgtcaagtcccgtagaccagtgtcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33184348 |
atgattcgtttctatagagatatgagtgaaactcatatcatcacaataagagagcttctaagattcatgctcactatcaagtcccgtagaccagtgtcaa |
33184249 |
T |
 |
| Q |
120 |
aaatgacagtcacttgttcttctcctaatgctgtttctgatactgattcaccttcttgttctacttcagcatttat |
195 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33184248 |
aaatgacagtcactttttcttctcctaatgctgtttctgatactgattcaccttcttgttctacttcagcatttat |
33184173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University