View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7428_low_21 (Length: 287)
Name: NF7428_low_21
Description: NF7428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7428_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 41 - 244
Target Start/End: Original strand, 2738536 - 2738739
Alignment:
| Q |
41 |
aagaatattaaacggagacaaatctatggcatatgtcttctattgtctacaaggtagcttctatatgtttgataggggttttcaattcaaatacttgcaa |
140 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2738536 |
aagaatattaaatggagacaaatctatggcatatgtcttctattgtctacaaggtagcttctatatgtttgataggggttttcaattcaaatacttgcaa |
2738635 |
T |
 |
| Q |
141 |
actgcaatgttgtgttggcttcattatctccatctccataaatgtatcttcttctatgaaaattttatattgatgtttggtgattataatgtaatcatga |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2738636 |
actgcaatgttgtgttggcttcattatctccatctccataaatgtatcttcttctatgaaaattttatattgatgtttggtgattataatgtaatcatga |
2738735 |
T |
 |
| Q |
241 |
tagt |
244 |
Q |
| |
|
|||| |
|
|
| T |
2738736 |
tagt |
2738739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University