View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7428_low_23 (Length: 270)
Name: NF7428_low_23
Description: NF7428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7428_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 5 - 255
Target Start/End: Original strand, 54237680 - 54237937
Alignment:
| Q |
5 |
ttctttctatctctattgattttgatcaacaaagagagaacaaaaagattgacctaaattatcacaaaatagatgtacaaatatttc--ctctttttaat |
102 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
54237680 |
ttctttctatctctattgttttttatcaacaaagagagaacaaaaaaattgacctaaattatcataaaatagatgtacaaatatttcttctctttttaat |
54237779 |
T |
 |
| Q |
103 |
atgtcgcatcggtcgttgaatttgcggccttgtctccgt-----ggacaatgtttaggatctgcagacagtaggtattatccgggcttttggcaggtggt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54237780 |
atgtcgcatcggtcgttgaatttgcggccttgtctccgtttgacggacaatgtttaggatttgcagacagtaggtattatccgggcttttggcaggtggt |
54237879 |
T |
 |
| Q |
198 |
atgtatcttgtttggctttgaaattttatggtttgctatcagtaaagttgcatatagt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54237880 |
atgtatcttgtttggctttgaaattttatggtttgctatcagtaaagttgcatatagt |
54237937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University