View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7428_low_24 (Length: 269)
Name: NF7428_low_24
Description: NF7428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7428_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 13885607 - 13885850
Alignment:
| Q |
1 |
tggtgttgaagtaacgaatcagtggacgagcggcgtaggagatgccaaagtaagacacagtggcagtgacgatggggcggcggcgaatgaatgtaggcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13885607 |
tggtgttgaagtaacgaatcagtggacgagcggcgtaggagatgccaaagtaagacacagtggcagtgacgatggggcggcggcgaatgaatgtaggcac |
13885706 |
T |
 |
| Q |
101 |
ggcggccttgaaggaggaagagaggaagcgggaaaatgtcattgtgttgaagaaatttgacttgacagtgtgagattttttagggatttatttaatgcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13885707 |
ggcggccttgaaggaggaagagaggaagcgggaaaatgccattgtgttgaagaaatttgacttgacagtgtgagattttttagggatttctttaatgcta |
13885806 |
T |
 |
| Q |
201 |
tgcttgattttagggtttatgtatagtgaaaagtgagaaatggttt |
246 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13885807 |
tgctttattttagggtttatg--tagtgaaaagtgagaaatggttt |
13885850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 115 - 168
Target Start/End: Original strand, 13875605 - 13875658
Alignment:
| Q |
115 |
aggaagagaggaagcgggaaaatgtcattgtgttgaagaaatttgacttgacag |
168 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
13875605 |
aggaagagaggaggcgggaaaatgccattgtgttgaagaaacttgacttcacag |
13875658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University