View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7428_low_29 (Length: 248)
Name: NF7428_low_29
Description: NF7428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7428_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 54 - 230
Target Start/End: Original strand, 29092835 - 29093011
Alignment:
| Q |
54 |
gcaaactagcacttgtgcataacttttcttcaaacatactgtcaattcattaaatcacgataacaattactcataacccaaagggggtcaaatacgaact |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29092835 |
gcaaactagcacttgtgcataacttttcttcaaaaatactgtcaattcattaaatcacgataacaattactcataacccaaagggggtcaaatacgaact |
29092934 |
T |
|
| Q |
154 |
taaacaatcacttgcaaattaggatgacgttggctttatgatgtcacgtaaacatgcacgtaacgccacgagtggtg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29092935 |
taaacaatcacttgcaaattaggatgacgttggctttataatgtcacgcaaacatgcacgtaacgccacgagtggtg |
29093011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University