View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7428_low_32 (Length: 236)
Name: NF7428_low_32
Description: NF7428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7428_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 44 - 217
Target Start/End: Complemental strand, 13885637 - 13885464
Alignment:
| Q |
44 |
gctcgttcactgattcgttacttcaacaccactgagcagaacgccaatgctgatgatcctcttcgccctttccgtgcgacggatgttttctatccaggaa |
143 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13885637 |
gctcgtccactgattcgttacttcaacaccactgagcagaacgccaatgctgatgatcctcttcgccctttccgtgcgacagatgttttctatccaggaa |
13885538 |
T |
|
| Q |
144 |
gaatgttgagtcggttcatgttttcgttgatcgatcgtcacgtcaacgtgagagagacagaggagtctattgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13885537 |
gaatgttgagtcggttcatgttttcgatgatcgatcgtcacgtcaacgtgagagagacagaggagtctattgtt |
13885464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University