View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7428_low_37 (Length: 215)
Name: NF7428_low_37
Description: NF7428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7428_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 34916013 - 34915828
Alignment:
| Q |
18 |
gttcatgccaactcttttgtaataattcactgaggatatgcatgagacttcatctggtacaacactattcaaaggcttggtttcttgagaaatattaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34916013 |
gttcatgccaactcttttgtaataattcactgaggatatgcatgagacttcatctggtacaacactattcaaaggcttggtttcttgagaaatattgaat |
34915914 |
T |
|
| Q |
118 |
ggaaaataattttggtttgtaaccatcatttccatttgattattcctttgagaaaggttgttgttcaaaccataaccacctccata |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34915913 |
ggaaaataattttggtttgtaaccatcatttccatttgattattcctttgagaaaggttgttgttcaaatcataaccacctccata |
34915828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University