View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7428_low_42 (Length: 202)
Name: NF7428_low_42
Description: NF7428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7428_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 21 - 189
Target Start/End: Complemental strand, 34443207 - 34443039
Alignment:
| Q |
21 |
catcgtcgtgttcttcctctttttgtggcacaggagctatcaatcttaaatcatctgcatttgagtttcttggtttactttttgattggcctttgtctcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
34443207 |
catcgtcgtgttcttcctctttttgtggcacaggagctatcaatcttaaatcatctgcatttgagtttcttggtttactttttgattgacctttctctcc |
34443108 |
T |
|
| Q |
121 |
accttttgataaaccaacaagccatttttgcgcgtcatcccacttagacggtgttggttttcccatatt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34443107 |
accttttgataaaccaacaagccatttttgcgcgtcatcccacttagacggtgttggttttcccatatt |
34443039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University