View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7429_high_24 (Length: 220)
Name: NF7429_high_24
Description: NF7429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7429_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 26540825 - 26541015
Alignment:
| Q |
18 |
cagtgccagtgccggtgacaccaaggtcttgcttattctcatcttttccagcaccaaagacaggaccacctttaccagcaggatcatggaccttctcttg |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26540825 |
cagtgccagtgccagtgacaccaaggtcttgcttattctcatctttgccagcaccaaagacaggaccaccttttccagcaggatcatggaccttctcttg |
26540924 |
T |
|
| Q |
118 |
cagcttatcaacttgaatgccaccttgatcttcctttgaaaacaaatcagttcttgtacgattttctcctccttctattgattcatatatt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26540925 |
cagcttatcaacttgaatgccaccttgatcttcctttgaaaacaaatcagttcttgtacgattttctcctccttctattgattcatatatt |
26541015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University