View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7429_low_10 (Length: 431)

Name: NF7429_low_10
Description: NF7429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7429_low_10
NF7429_low_10
[»] chr2 (36 HSPs)
chr2 (95-412)||(14405099-14405416)
chr2 (151-407)||(7874247-7874504)
chr2 (174-407)||(14106390-14106626)
chr2 (198-407)||(5254260-5254466)
chr2 (158-401)||(39338738-39338983)
chr2 (173-401)||(387151-387382)
chr2 (7-93)||(14404981-14405067)
chr2 (179-322)||(22885088-22885229)
chr2 (206-326)||(2062901-2063019)
chr2 (158-322)||(10173532-10173696)
chr2 (158-401)||(10524060-10524308)
chr2 (191-322)||(1269480-1269609)
chr2 (201-307)||(16959989-16960093)
chr2 (224-407)||(16952252-16952434)
chr2 (224-407)||(17022917-17023099)
chr2 (224-407)||(17060223-17060405)
chr2 (178-243)||(9560820-9560886)
chr2 (204-278)||(15126407-15126481)
chr2 (204-322)||(33788587-33788703)
chr2 (205-273)||(4471934-4472002)
chr2 (215-278)||(7695984-7696047)
chr2 (357-407)||(7460839-7460889)
chr2 (202-272)||(13337282-13337352)
chr2 (195-326)||(27739976-27740105)
chr2 (205-254)||(4162041-4162090)
chr2 (191-280)||(18681062-18681151)
chr2 (193-246)||(23650384-23650437)
chr2 (224-307)||(17079199-17079281)
chr2 (205-255)||(25504929-25504979)
chr2 (158-263)||(31902426-31902532)
chr2 (216-307)||(3745356-3745446)
chr2 (178-238)||(8520385-8520446)
chr2 (158-246)||(37770670-37770759)
chr2 (153-238)||(41086825-41086910)
chr2 (158-252)||(17105374-17105470)
chr2 (191-269)||(36276178-36276255)
[»] chr3 (32 HSPs)
chr3 (151-407)||(23328218-23328475)
chr3 (151-418)||(40023429-40023696)
chr3 (175-410)||(45398776-45399012)
chr3 (193-322)||(43012374-43012503)
chr3 (158-330)||(19176466-19176638)
chr3 (245-412)||(21342586-21342753)
chr3 (160-316)||(2392466-2392622)
chr3 (158-319)||(9584009-9584171)
chr3 (158-316)||(20611746-20611904)
chr3 (158-316)||(34475714-34475872)
chr3 (205-316)||(17550968-17551078)
chr3 (160-273)||(2394255-2394369)
chr3 (155-263)||(14193900-14194009)
chr3 (204-322)||(33143903-33144020)
chr3 (191-406)||(14879432-14879646)
chr3 (166-308)||(45163824-45163968)
chr3 (201-278)||(47945713-47945790)
chr3 (225-316)||(47235729-47235819)
chr3 (158-278)||(37123345-37123466)
chr3 (193-316)||(31482883-31483005)
chr3 (201-255)||(14755285-14755339)
chr3 (158-263)||(25647647-25647753)
chr3 (191-299)||(1652864-1652970)
chr3 (205-263)||(5556581-5556639)
chr3 (209-262)||(39021289-39021342)
chr3 (204-243)||(20710740-20710779)
chr3 (190-257)||(24099345-24099412)
chr3 (194-320)||(27398958-27399083)
chr3 (158-263)||(30935402-30935508)
chr3 (205-263)||(30127273-30127332)
chr3 (257-316)||(53247963-53248021)
chr3 (171-247)||(31424212-31424289)
[»] chr7 (40 HSPs)
chr7 (151-407)||(34389918-34390175)
chr7 (163-331)||(6584877-6585046)
chr7 (151-407)||(35745690-35745952)
chr7 (158-330)||(41089693-41089866)
chr7 (158-401)||(3867079-3867324)
chr7 (153-319)||(33435067-33435234)
chr7 (158-308)||(3419623-3419774)
chr7 (158-316)||(47325845-47326003)
chr7 (218-412)||(48161890-48162083)
chr7 (158-316)||(38306224-38306382)
chr7 (158-406)||(8745116-8745363)
chr7 (163-401)||(37794957-37795197)
chr7 (158-316)||(10244145-10244303)
chr7 (166-316)||(5860248-5860398)
chr7 (158-300)||(25160778-25160918)
chr7 (216-316)||(44353524-44353623)
chr7 (158-406)||(24324668-24324916)
chr7 (158-326)||(42533204-42533370)
chr7 (158-314)||(1320757-1320913)
chr7 (194-315)||(3478352-3478471)
chr7 (158-263)||(6716748-6716854)
chr7 (205-263)||(13311850-13311908)
chr7 (158-263)||(16954616-16954722)
chr7 (191-272)||(12480883-12480965)
chr7 (150-283)||(23983150-23983284)
chr7 (158-247)||(38485519-38485609)
chr7 (158-263)||(47457034-47457140)
chr7 (191-299)||(46133254-46133362)
chr7 (202-246)||(9349757-9349801)
chr7 (158-263)||(16828948-16829054)
chr7 (205-243)||(27993568-27993606)
chr7 (357-404)||(6585045-6585092)
chr7 (205-263)||(11379139-11379197)
chr7 (205-239)||(25153231-25153265)
chr7 (158-231)||(44755590-44755663)
chr7 (205-243)||(46262151-46262189)
chr7 (206-254)||(17802837-17802885)
chr7 (204-272)||(48058657-48058725)
chr7 (205-263)||(1820014-1820072)
chr7 (205-243)||(35206725-35206763)
[»] chr1 (34 HSPs)
chr1 (151-407)||(27031708-27031965)
chr1 (151-406)||(46814336-46814592)
chr1 (151-406)||(24658885-24659140)
chr1 (151-407)||(7857609-7857866)
chr1 (153-322)||(24684431-24684601)
chr1 (158-316)||(46692779-46692937)
chr1 (158-316)||(41920416-41920573)
chr1 (158-316)||(5389381-5389539)
chr1 (158-316)||(24449890-24450048)
chr1 (158-316)||(30685864-30686022)
chr1 (158-316)||(31585720-31585878)
chr1 (167-316)||(5459133-5459282)
chr1 (191-295)||(17033583-17033687)
chr1 (191-255)||(6583236-6583300)
chr1 (158-257)||(9313307-9313407)
chr1 (216-322)||(27102213-27102317)
chr1 (158-274)||(20113522-20113639)
chr1 (158-247)||(4651743-4651833)
chr1 (204-278)||(19598646-19598720)
chr1 (191-263)||(34774868-34774940)
chr1 (178-255)||(38544758-38544835)
chr1 (192-247)||(15840940-15840995)
chr1 (192-278)||(32864558-32864644)
chr1 (193-238)||(27905411-27905456)
chr1 (206-247)||(42374175-42374216)
chr1 (207-247)||(42374049-42374089)
chr1 (204-307)||(50589177-50589278)
chr1 (190-269)||(2877633-2877711)
chr1 (224-278)||(10785456-10785510)
chr1 (205-243)||(17891522-17891560)
chr1 (205-247)||(30655571-30655613)
chr1 (209-238)||(18787241-18787270)
chr1 (205-246)||(22200019-22200060)
chr1 (211-243)||(9081537-9081569)
[»] chr8 (28 HSPs)
chr8 (151-412)||(15821242-15821504)
chr8 (158-330)||(36630800-36630973)
chr8 (225-407)||(38577657-38577840)
chr8 (158-316)||(24995355-24995513)
chr8 (158-316)||(32066255-32066413)
chr8 (158-316)||(31207322-31207479)
chr8 (158-316)||(34388965-34389123)
chr8 (158-316)||(37986818-37986976)
chr8 (158-307)||(9519462-9519611)
chr8 (174-316)||(16457421-16457562)
chr8 (158-263)||(10248565-10248671)
chr8 (201-406)||(17656873-17657076)
chr8 (216-316)||(20138448-20138547)
chr8 (158-278)||(30236125-30236246)
chr8 (200-309)||(41893368-41893475)
chr8 (194-273)||(15906686-15906765)
chr8 (158-247)||(10552232-10552321)
chr8 (172-316)||(12898234-12898378)
chr8 (204-315)||(12198030-12198140)
chr8 (204-315)||(12442458-12442568)
chr8 (280-342)||(35816176-35816238)
chr8 (191-307)||(35062454-35062568)
chr8 (160-322)||(17720661-17720821)
chr8 (191-278)||(32945700-32945787)
chr8 (204-247)||(23264716-23264759)
chr8 (204-243)||(40531242-40531281)
chr8 (205-243)||(33967337-33967375)
chr8 (357-401)||(31207235-31207279)
[»] chr4 (33 HSPs)
chr4 (151-407)||(2825739-2825996)
chr4 (151-407)||(31050529-31050787)
chr4 (222-407)||(35341207-35341391)
chr4 (158-316)||(8254990-8255148)
chr4 (158-316)||(8268408-8268566)
chr4 (158-316)||(30964404-30964562)
chr4 (158-401)||(4305688-4305932)
chr4 (158-322)||(53823376-53823539)
chr4 (158-310)||(25753135-25753286)
chr4 (169-263)||(19815236-19815331)
chr4 (217-316)||(30167524-30167622)
chr4 (191-263)||(22811172-22811244)
chr4 (158-322)||(2061693-2061856)
chr4 (191-299)||(35800486-35800592)
chr4 (158-278)||(38929790-38929911)
chr4 (191-263)||(49747524-49747596)
chr4 (204-278)||(16501741-16501815)
chr4 (205-322)||(38637188-38637302)
chr4 (191-252)||(21387227-21387288)
chr4 (218-322)||(41117922-41118024)
chr4 (158-301)||(19673064-19673205)
chr4 (191-263)||(46698797-46698869)
chr4 (191-265)||(36962626-36962699)
chr4 (191-263)||(6599957-6600029)
chr4 (224-278)||(28966897-28966951)
chr4 (205-247)||(39041302-39041344)
chr4 (208-246)||(39421042-39421080)
chr4 (205-243)||(40813813-40813851)
chr4 (204-240)||(53756766-53756802)
chr4 (194-299)||(12296175-12296278)
chr4 (166-247)||(19311371-19311451)
chr4 (205-238)||(37707392-37707425)
chr4 (191-247)||(2165505-2165560)
[»] chr5 (25 HSPs)
chr5 (158-401)||(29087444-29087688)
chr5 (158-316)||(34378061-34378219)
chr5 (158-316)||(698324-698482)
chr5 (158-326)||(13954185-13954351)
chr5 (158-309)||(18593206-18593357)
chr5 (158-256)||(7392050-7392149)
chr5 (158-330)||(14302377-14302548)
chr5 (197-273)||(22675326-22675402)
chr5 (239-322)||(7162270-7162353)
chr5 (158-406)||(8297431-8297678)
chr5 (158-322)||(7195195-7195356)
chr5 (194-272)||(26045967-26046045)
chr5 (158-255)||(33258902-33259000)
chr5 (206-322)||(39184140-39184256)
chr5 (204-298)||(27713079-27713171)
chr5 (194-252)||(23426344-23426402)
chr5 (158-247)||(31721640-31721730)
chr5 (191-264)||(24072277-24072350)
chr5 (194-258)||(25992007-25992071)
chr5 (205-255)||(8730928-8730978)
chr5 (191-247)||(12046252-12046308)
chr5 (209-259)||(21402853-21402903)
chr5 (178-247)||(28765630-28765700)
chr5 (223-273)||(39024452-39024502)
chr5 (160-263)||(17854079-17854183)
[»] scaffold0068 (1 HSPs)
scaffold0068 (158-308)||(35740-35889)
[»] chr6 (19 HSPs)
chr6 (158-316)||(3117456-3117614)
chr6 (158-272)||(16510304-16510419)
chr6 (158-353)||(20701727-20701921)
chr6 (191-330)||(32935286-32935423)
chr6 (195-297)||(9224042-9224143)
chr6 (210-263)||(13423482-13423535)
chr6 (191-252)||(26216042-26216102)
chr6 (191-252)||(26534742-26534803)
chr6 (185-273)||(21266104-21266192)
chr6 (191-247)||(34105410-34105466)
chr6 (151-213)||(15132585-15132648)
chr6 (205-240)||(7546464-7546499)
chr6 (194-252)||(12794114-12794173)
chr6 (158-235)||(3880623-3880701)
chr6 (218-263)||(33968625-33968670)
chr6 (205-247)||(34090374-34090416)
chr6 (191-240)||(20499916-20499965)
chr6 (205-241)||(12129228-12129264)
chr6 (185-273)||(21264977-21265065)
[»] scaffold0200 (1 HSPs)
scaffold0200 (191-322)||(19380-19509)
[»] scaffold0119 (1 HSPs)
scaffold0119 (191-322)||(42093-42222)
[»] scaffold0050 (1 HSPs)
scaffold0050 (158-260)||(36670-36773)
[»] scaffold1613 (1 HSPs)
scaffold1613 (178-255)||(1037-1114)
[»] scaffold0343 (1 HSPs)
scaffold0343 (236-309)||(5747-5820)
[»] scaffold0063 (1 HSPs)
scaffold0063 (192-313)||(58125-58244)
[»] scaffold0620 (1 HSPs)
scaffold0620 (191-247)||(3827-3883)
[»] scaffold0499 (1 HSPs)
scaffold0499 (204-298)||(6568-6660)


Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 36)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 95 - 412
Target Start/End: Original strand, 14405099 - 14405416
Alignment:
95 atctaagtgttgacgatcttgatctatcccttatcacctatcaagatggtctatattatggtgttctctggtgtaccgggggcgaggggtgcctgatgat 194  Q
    ||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||| |||||||    
14405099 atctaagtgttgacgatcttgatctatcctttatcacctatcaaggtggtccatattatgttgttctctggtgtaccgggggcgaggggtgcttgatgat 14405198  T
195 ttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcg 294  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
14405199 ttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggcttttgttttgtgctctttcg 14405298  T
295 gtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagcttttcgctcgtggctcgacttgggtgttgaagtttgggagttttatt 394  Q
    |||||||||| |||||| |||||||||||||||| |||||||||||||| ||||| ||||  |||||||||||||||||||||||| |||||||||||||    
14405299 gtggatcagaagtcgagtggttgtggaaactgcacgttcatttggttaggagcttgtcgcatgtggctcgacttgggtgttgaagtctgggagttttatt 14405398  T
395 ttgaggggtgttcgtttg 412  Q
    ||||||| ||||| ||||    
14405399 ttgagggatgttcttttg 14405416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 151 - 407
Target Start/End: Original strand, 7874247 - 7874504
Alignment:
151 tatggtgttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagct 249  Q
    ||||||||||||| |||||||| |||||| ||||||| || ||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||    
7874247 tatggtgttctctagtgtaccgagggcgatgggtgccctgctgatttggttctaaagtctggtgggtcgatcacttttgattcgagatcgggagtcagct 7874346  T
250 ctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagctt 349  Q
    ||||| |||||||||||||||||| ||||||||||||||| ||||||||||| ||||||||||||||||||||||| | ||||||||||||||| |||||    
7874347 ctttgactcaagttggtttttgggcttttgttttgtgctcattcggtggatcggaggtcgagaggttgtggaaactacttgttcatttggttaggagctt 7874446  T
350 ttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttc 407  Q
    ||||   |||||||  ||||||||||||||| | |||||||||||||||||| |||||    
7874447 ttcgaatgtggctcagcttgggtgttgaagtcttggagttttattttgagggatgttc 7874504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 174 - 407
Target Start/End: Complemental strand, 14106626 - 14106390
Alignment:
174 gggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagtt-ggtttttg 271  Q
    |||||||||||||| || ||||||||| |||||||||||||| ||||||||||||||||| |||||||||||||||||||| | |||  || ||||||||    
14106626 gggcgaggggtgccctgctgatttggtcctaaagtctggtgggccgatcacttttgattcaagatcgggagtcagctctttagatcagttttggtttttg 14106527  T
272 ggattttgtttt-gtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagcttttcgctcgtggctcgacttgg 370  Q
    || ||||||||| |||||||||||||||||||||||||||||||||||||||  || ||| ||||| |||||  |||||| ||   |||||||  |||||    
14106526 ggtttttgtttttgtgctctttcggtggatcagaggtcgagaggttgtggaagttgtatgatcattcggttaagagctttacgaatgtggctcagcttgg 14106427  T
371 gtgttgaagtttgggagttttattttgaggggtgttc 407  Q
    |||||||||| || |||||||||||||||||||||||    
14106426 gtgttgaagtctgagagttttattttgaggggtgttc 14106390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 198 - 407
Target Start/End: Original strand, 5254260 - 5254466
Alignment:
198 gttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtg 297  Q
    |||||||||||| |||| |||||||||||| ||| ||||||||||||| ||||||||| ||||||||||||| ||| |||||||||||||| ||||||||    
5254260 gttctaaagtctagtgggccgatcacttttaatttgagatcgggagtctgctctttggttcaagttggttttcgggcttttgttttgtgctttttcggtg 5254359  T
298 gatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagcttttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttg 397  Q
    |||| |||||||||||||||||||| ||||||||||||| |||| | |||||||||   |||||||   |||||||||||||| || |||||   |||||    
5254360 gatcggaggtcgagaggttgtggaagctgcatgttcattcggtttggagcttttcgaatgtggctcagtttgggtgttgaagtctgagagtt---ttttg 5254456  T
398 aggggtgttc 407  Q
    ||||||||||    
5254457 aggggtgttc 5254466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 158 - 401
Target Start/End: Complemental strand, 39338983 - 39338738
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||| ||||||||||||||||||||||||| || | ||||||| ||| |||||||||| |||||| ||||||||||||||||||||||||| |||||| |    
39338983 ttctttggtgtaccgggggcgaggggtgccctgctaatttggtactatagtctggtgggccgatcgcttttgattcgagatcgggagtcagttctttgac 39338884  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagagg-ttgtggaaactgcatgttcatttggttagtagcttttcg-c 354  Q
    |||||||||||||||||  ||||| |||||||||||||||||||| ||||||| |||| |||||  | ||| ||| || || ||||||  ||| ||||      
39338883 tcaagttggtttttggg-ctttgtgttgtgctctttcggtggatcggaggtcgcgaggtttgtgatagctgaatgatccttcggttaggtgctcttcgaa 39338785  T
355 tcgtggctcgacttgggtgttgaagtttgggagttttattttgaggg 401  Q
    | ||| |||  |||||||||||| || ||||||||||||||||||||    
39338784 ttgtgactcagcttgggtgttgaggtctgggagttttattttgaggg 39338738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 173 - 401
Target Start/End: Original strand, 387151 - 387382
Alignment:
173 ggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttg 271  Q
    ||||||||||||||| || | ||||||| |||||||||||||| | |||||||||||||| ||||||||||||||  |||||| ||||||||||||||||    
387151 ggggcgaggggtgccctgctaatttggtactaaagtctggtgggctgatcacttttgatttgagatcgggagtcaattctttgactcaagttggtttttg 387250  T
272 ggattttg-ttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagcttttcgct-cgtggctcgacttg 369  Q
     | ||||| ||||||||||||| |||||||| ||||||  |||||| ||||| |||||||||||||  || ||  ||| |||| |  |||||||  ||||    
387251 agcttttgtttttgtgctcttttggtggatcggaggtcacgaggttttggaagctgcatgttcattcagtcaggtgctcttcgataggtggctcagcttg 387350  T
370 ggtgttgaagtttgggagttttattttgaggg 401  Q
    |||||||  || ||||||||||||||||||||    
387351 ggtgttggggtctgggagttttattttgaggg 387382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 7 - 93
Target Start/End: Original strand, 14404981 - 14405067
Alignment:
7 gtttggaggtcgaaatatacaatggtcggaaaacctgcagaaccgaagattgaggagagatcgatatataaagaatcaaatacataa 93  Q
    ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14404981 gtttggaggtcaaaatatacaatggtcgaaaaacctgcagaaccgaagattgaggagagatcgatatataaagaatcaaatacataa 14405067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 179 - 322
Target Start/End: Complemental strand, 22885229 - 22885088
Alignment:
179 aggggtgcctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggatttt 278  Q
    ||||||||| | || |||| | || ||||||||||| |||||||||||||||||||||||||||||||| ||||||| ||||||| | |||||||   ||    
22885229 aggggtgcccgctggtttgatcctgaagtctggtgggccgatcacttttgattcgagatcgggagtcagttctttggttcaagtttggttttggg---tt 22885133  T
279 gtttt-gtgctctttcggtggatcagaggtcgagaggttgtggaa 322  Q
    ||||| ||| |||||||||||| ||||||| ||||||| ||||||    
22885132 gttttggtgttctttcggtggaccagaggttgagaggtggtggaa 22885088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 206 - 326
Target Start/End: Original strand, 2062901 - 2063019
Alignment:
206 gtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagag 305  Q
    ||||||||| |||||  ||||||||||||||||||||||||||||||||||||||||| | ||||||| |||  ||| ||| |||||||||| | |||||    
2062901 gtctggtgggccgattgcttttgattcgagatcgggagtcagctctttggctcaagtttggttttgggcttt--tttggtgttctttcggtgtaccagag 2062998  T
306 gtcgagaggttgtggaaactg 326  Q
    || | ||||||||||||||||    
2062999 gttgtgaggttgtggaaactg 2063019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 158 - 322
Target Start/End: Complemental strand, 10173696 - 10173532
Alignment:
158 ttctctggtgtaccgggggcgaggggtgc-ctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||||| | || || |||||| ||  || |||||| ||||||||| |||| ||||||||||||||||||||||||| ||| || | ||||||    
10173696 ttctctggtgtaccagaggtgaagggtgctcttttgttttggtcctaaagtctagtgggccgatcacttttgattcgagatcggaagtaagttatttggc 10173597  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaa 322  Q
    ||||||| | ||||||| ||||| || ||| |||||||||| ||| ||||||||||||| ||||||    
10173596 tcaagtttggttttgggcttttg-ttggtgttctttcggtgaatcggaggtcgagaggtggtggaa 10173532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 158 - 401
Target Start/End: Original strand, 10524060 - 10524308
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtca----gctctt 252  Q
    ||||||||| ||| ||||||||| |||||| ||   ||||||| ||| |||||||||| |||||||||||||||||||||||||||||||      ||||    
10524060 ttctctggtctactgggggcgagaggtgccctgccaatttggtgctatagtctggtgggccgatcacttttgattcgagatcgggagtcaatatattctt 10524159  T
253 tggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagagg-ttgtggaaactgcatgttcatttggttagtagctttt 351  Q
    || ||||||||||||||||||  ||||| ||||||||||||||| | || ||||||| |||| |||||  | ||||||| || || ||||||  ||| ||    
10524160 tgactcaagttggtttttggg-ctttgtgttgtgctctttcggt-gttcggaggtcgcgaggtttgtgatagctgcatgatccttcggttaggtgctctt 10524257  T
352 cgct-cgtggctcgacttgggtgttgaagtttgggagttttattttgaggg 401  Q
    || |  |||||||  |||||||||||  ||||||||||||||||| |||||    
10524258 cgatatgtggctcagcttgggtgttggggtttgggagttttatttggaggg 10524308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 191 - 322
Target Start/End: Original strand, 1269480 - 1269609
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctct 290  Q
    |||||| || |||||||||||||| ||||||||||||||||||||||||| |||||| ||||||||||||||| | |||||||||||  || ||   |||    
1269480 tgatttagtcctaaagtctggtgggccgatcacttttgattcgagatcggaagtcagttctttggctcaagtttggttttgggattt--ttatggtttct 1269577  T
291 ttcggtggatcagaggtcgagaggttgtggaa 322  Q
    ||| ||||||| ||||||||||| | ||||||    
1269578 ttcagtggatcggaggtcgagagttggtggaa 1269609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 201 - 307
Target Start/End: Original strand, 16959989 - 16960093
Alignment:
201 ctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggat 300  Q
    |||||||||||||| |||||| ||||||||||||||||| ||||||| ||||||||||||||| | |||||||   || ||| ||| ||||||||||||     
16959989 ctaaagtctggtgggccgatcgcttttgattcgagatcgagagtcagttctttggctcaagtttggttttggg--cttatttggtgttctttcggtggac 16960086  T
301 cagaggt 307  Q
    |||||||    
16960087 cagaggt 16960093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 224 - 407
Target Start/End: Complemental strand, 16952434 - 16952252
Alignment:
224 ttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaa 323  Q
    |||||||||||||||||||| ||| ||||||||||||||| | |||| |||  || ||| ||| |||||||||||||| ||||| ||||||| ||||||     
16952434 ttttgattcgagatcgggagccagttctttggctcaagtttggtttt-ggacattttttggtgttctttcggtggatcggaggttgagaggtggtggaag 16952336  T
324 ctgcatgttcatttggttagtagcttttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttc 407  Q
    ||  | | || || || ||| |||||||||   |||| || |||| |||||||| |  ||||||||| |||| |||||||||||    
16952335 ctaaacgatctttcggataggagcttttcggatgtggatcaactttggtgttgaggactgggagtttcatttagaggggtgttc 16952252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 224 - 407
Target Start/End: Complemental strand, 17023099 - 17022917
Alignment:
224 ttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaa 323  Q
    |||||||||||||||||||| ||| ||||||||||||||| | |||| |||  || ||| ||| |||||||||||||| ||||| ||||||| ||||||     
17023099 ttttgattcgagatcgggagccagttctttggctcaagtttggtttt-ggacattttttggtgttctttcggtggatcggaggttgagaggtggtggaag 17023001  T
324 ctgcatgttcatttggttagtagcttttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttc 407  Q
    ||  | | || || || ||| |||||||||   |||| || |||| |||||||| |  ||||||||| |||| |||||||||||    
17023000 ctaaacgatctttcggataggagcttttcggatgtggatcaactttggtgttgaggactgggagtttcatttagaggggtgttc 17022917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 224 - 407
Target Start/End: Complemental strand, 17060405 - 17060223
Alignment:
224 ttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaa 323  Q
    |||||||||||||||||||| ||| ||||||||||||||| | |||| |||  || ||| ||| |||||||||||||| ||||| ||||||| ||||||     
17060405 ttttgattcgagatcgggagccagttctttggctcaagtttggtttt-ggacattttttggtgttctttcggtggatcggaggttgagaggtggtggaag 17060307  T
324 ctgcatgttcatttggttagtagcttttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttc 407  Q
    ||  | | || || || ||| |||||||||   |||| || |||| |||||||| |  ||||||||| |||| |||||||||||    
17060306 ctaaacgatctttcggataggagcttttcggatgtggatcaactttggtgttgaggactgggagtttcatttagaggggtgttc 17060223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 178 - 243
Target Start/End: Complemental strand, 9560886 - 9560820
Alignment:
178 gaggggtgcct-gatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggag 243  Q
    ||||||||||| |||||||||  || ||||| |||||||||||||||||||||||||||||||||||    
9560886 gaggggtgccttgatgatttgtgtcgaaagtttggtggaccgatcacttttgattcgagatcgggag 9560820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 204 - 278
Target Start/End: Complemental strand, 15126481 - 15126407
Alignment:
204 aagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggatttt 278  Q
    ||||||||||| ||||||| |||||||||||||||||||||| | ||||||||||| ||| | ||||||| ||||    
15126481 aagtctggtgggccgatcatttttgattcgagatcgggagtcggttctttggctcatgtttggttttgggctttt 15126407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 204 - 322
Target Start/End: Complemental strand, 33788703 - 33788587
Alignment:
204 aagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgtttt-gtgctctttcggtggatca 302  Q
    ||||||||||| |||||| ||||||||||||||| ||||||||| ||||||| ||| ||| |  ||||||   ||||||| ||| |||||||||| | ||    
33788703 aagtctggtgggccgatcgcttttgattcgagattgggagtcagttctttggttcaggtttggctttggg---ttgttttggtgttctttcggtgaacca 33788607  T
303 gaggtcgagaggttgtggaa 322  Q
    ||||| ||||||| ||||||    
33788606 gaggttgagaggtggtggaa 33788587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 205 - 273
Target Start/End: Original strand, 4471934 - 4472002
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttggg 273  Q
    |||||||||| |||||| | ||||||||||||||||||||||| ||||||  ||||||| |||||||||    
4471934 agtctggtgggccgatcgcctttgattcgagatcgggagtcagttctttgattcaagtttgtttttggg 4472002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 215 - 278
Target Start/End: Original strand, 7695984 - 7696047
Alignment:
215 accgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggatttt 278  Q
    |||||||||||||||||||| | |||||||||| ||||||||||||||| | ||||||| ||||    
7695984 accgatcacttttgattcgataccgggagtcagttctttggctcaagttaggttttgggctttt 7696047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 357 - 407
Target Start/End: Original strand, 7460839 - 7460889
Alignment:
357 gtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttc 407  Q
    |||||||  ||||||||||||||| ||||||||||||||||||||||||||    
7460839 gtggctcagcttgggtgttgaagtctgggagttttattttgaggggtgttc 7460889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 202 - 272
Target Start/End: Original strand, 13337282 - 13337352
Alignment:
202 taaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgg 272  Q
    ||||||||| ||| ||||||||||||||||||| ||||| |||||| |||||| |||||||| | ||||||    
13337282 taaagtctgatgggccgatcacttttgattcgaaatcggaagtcagttctttgactcaagttaggttttgg 13337352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 195 - 326
Target Start/End: Original strand, 27739976 - 27740105
Alignment:
195 ttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgtttt-gtgctctttc 293  Q
    ||||| || ||||||||||| |||||| |||||||||| |||||| |||||||   || || ||||||| | | |||||   ||||||| ||| ||||||    
27739976 ttggtcctgaagtctggtgggccgatcgcttttgattcaagatcgagagtcagtgtttcggttcaagtttggtcttggg---ttgttttggtgttctttc 27740072  T
294 ggtggatcagaggtcgagaggttgtggaaactg 326  Q
    |||||| ||||||| ||||||| ||||||||||    
27740073 ggtggaccagaggttgagaggtggtggaaactg 27740105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 205 - 254
Target Start/End: Complemental strand, 4162090 - 4162041
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggagtcagctctttg 254  Q
    |||||||||| |||||||||||||||||||||||||||| ||||| ||||    
4162090 agtctggtgggccgatcacttttgattcgagatcgggagccagctttttg 4162041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 191 - 280
Target Start/End: Original strand, 18681062 - 18681151
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgt 280  Q
    |||||||||| | |||| |||||| |||||  | ||||||||||||||||||||||| ||| ||| ||||||| | ||||||| ||||||    
18681062 tgatttggttatgaagtatggtgggccgattgcatttgattcgagatcgggagtcagttctctggttcaagtttggttttgggcttttgt 18681151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 193 - 246
Target Start/End: Original strand, 23650384 - 23650437
Alignment:
193 atttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtca 246  Q
    ||||||||||| |||||||||| | |||| ||||||||||||||||||||||||    
23650384 atttggttctagagtctggtgggctgatcgcttttgattcgagatcgggagtca 23650437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 224 - 307
Target Start/End: Original strand, 17079199 - 17079281
Alignment:
224 ttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggt 307  Q
    |||||||||||||||||||| ||| ||||||||||||||| | |||| |||  || ||| ||| |||||||||||||| |||||    
17079199 ttttgattcgagatcgggagccagttctttggctcaagtttggtttt-ggacattttttggtgttctttcggtggatcggaggt 17079281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 205 - 255
Target Start/End: Complemental strand, 25504979 - 25504929
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggagtcagctctttgg 255  Q
    ||||||||||||| ||| ||||| ||||||||||||||||||| |||||||    
25504979 agtctggtggacctatcgcttttaattcgagatcgggagtcagttctttgg 25504929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 158 - 263
Target Start/End: Complemental strand, 31902532 - 31902426
Alignment:
158 ttctctggtgtaccgggggcgaggggtg-cctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||| ||||||||  ||||||| |||  | ||||| | || ||||||||||| || ||| ||||| ||||||||||||||||||| ||| |||     
31902532 ttctctggtggaccgggggttaggggtgtccttcttatttgatgctgaagtctggtgggccaatcgcttttaattcgagatcgggagtcagttctctggt 31902433  T
257 tcaagtt 263  Q
    |||||||    
31902432 tcaagtt 31902426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 216 - 307
Target Start/End: Original strand, 3745356 - 3745446
Alignment:
216 ccgatcacttttgattcgagatcgggagtcagctctttggctcaag-ttggtttttgggattttgttttgtgctctttcggtggatcagaggt 307  Q
    |||||| ||||| |||||||||||| |||||| ||||||| | ||| || ||||||||| |||| | ||||  ||||||||||||||||||||    
3745356 ccgatcgcttttaattcgagatcggaagtcagttctttggtttaagttttgtttttgggcttttttgttgt--tctttcggtggatcagaggt 3745446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 178 - 238
Target Start/End: Original strand, 8520385 - 8520446
Alignment:
178 gaggggtgcctga-tgatttggttctaaagtctggtggaccgatcacttttgattcgagatc 238  Q
    ||||||||||| | ||||||| ||||| |||||| |||||| ||||||||||||||||||||    
8520385 gaggggtgccttagtgatttgtttctagagtctgatggaccaatcacttttgattcgagatc 8520446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 158 - 246
Target Start/End: Complemental strand, 37770759 - 37770670
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcctga-tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtca 246  Q
    ||||||||||||||| ||| ||||||||||    ||||||||| |||| || |||||| |||||||||||||||||  |||| |||||||    
37770759 ttctctggtgtaccgagggtgaggggtgcccatctgatttggtcctaaggtttggtgggccgatcacttttgattctggatcaggagtca 37770670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 153 - 238
Target Start/End: Complemental strand, 41086910 - 41086825
Alignment:
153 tggtgttctctggtgtaccgggggcgaggggtgcctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatc 238  Q
    ||||||||||||||||||| |||| |||||   |||  |||||||||  || ||||||||||  | ||||||||||||||||||||    
41086910 tggtgttctctggtgtaccaggggtgagggtgcccttctgatttggtcatatagtctggtgggtcaatcacttttgattcgagatc 41086825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 158 - 252
Target Start/End: Original strand, 17105374 - 17105470
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcctga-tgatttggttctaaagtctggtggaccgatcac-ttttgattcgagatcgggagtcagctctt 252  Q
    |||| ||||||||| |||| ||||||||||  | ||||||||| || ||||||| ||| |||||||| |||||||||||||||| || |||| ||||    
17105374 ttctttggtgtaccaggggtgaggggtgccctactgatttggtactgaagtctgatgggccgatcactttttgattcgagatcgagaatcagatctt 17105470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 191 - 269
Target Start/End: Complemental strand, 36276255 - 36276178
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttt 269  Q
    |||||||||| |  |||||||||| | | || ||||||||||||||||||||||||  |||||| |||||||| |||||    
36276255 tgatttggttatggagtctggtgggctgttcgcttttgattcgagatcgggagtca-atctttgactcaagtttgtttt 36276178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 174; Significance: 2e-93; HSPs: 32)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 151 - 407
Target Start/End: Complemental strand, 23328475 - 23328218
Alignment:
151 tatggtgttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagct 249  Q
    ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||    
23328475 tatggtgttctctggtgtaccgggggcgaggggtgccctgttgatttggttctaaagtttggtggaccgatcacttttgattcgagatcgggagttagct 23328376  T
250 ctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagctt 349  Q
     ||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||||||||||| || | |||||||| |||||| |||||    
23328375 ttttggctcaagttggtttttgagcttttgttttgtgctctttcggtggatcggaggtcgagaggttgtggaagctccttgttcattcggttaggagctt 23328276  T
350 ttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttc 407  Q
    ||||   |||||||  ||||||||||||||| |||||||||||||||||| |||||||    
23328275 ttcgaatgtggctcagcttgggtgttgaagtctgggagttttattttgagtggtgttc 23328218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 156; E-Value: 1e-82
Query Start/End: Original strand, 151 - 418
Target Start/End: Complemental strand, 40023696 - 40023429
Alignment:
151 tatggtgttctctggtgtaccgggggcgaggggtgcctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctc 250  Q
    ||||||||||||| ||||||||||||||||||   |||| |||||| ||| ||||||||||||||||||||||||||||||||||||||||||||   ||    
40023696 tatggtgttctctagtgtaccgggggcgagggtgccctgctgattttgttttaaagtctggtggaccgatcacttttgattcgagatcgggagtcgattc 40023597  T
251 tttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagcttt 350  Q
    ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||| ||||||||||||| |||||| ||||||    
40023596 tttggcttaagttggtttttgggcttttgttttgtgctctttcggtggatcagaggacgggaggttgtggaagctgcatgttcattcggttaggagcttt 40023497  T
351 tcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttcgtttgtgatga 418  Q
    |||   |||||||  || |||||||| ||| ||||||||||||||||||||| |||| |||| |||||    
40023496 tcgaatgtggctcagctagggtgttgtagtctgggagttttattttgaggggcgttcttttgggatga 40023429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 175 - 410
Target Start/End: Original strand, 45398776 - 45399012
Alignment:
175 ggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttggg 273  Q
    ||||||||||||| || |||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||||||  | |||||||||||||||    
45398776 ggcgaggggtgccctgctgatttggatttaaagtctggtggaccgatcacttttgattcgagatcgagagtcagctctttgatttaagttggtttttggg 45398875  T
274 attttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagcttttcgctcgtggctcgacttgggtg 373  Q
     ||||||||| |||||||||| |||||| |||||||||||||||||||| ||||||||||||| |||||  |||||||||   ||||| | |||| ||||    
45398876 cttttgttttatgctctttcgatggatcggaggtcgagaggttgtggaagctgcatgttcattcggttatgagcttttcgaatgtggcgcaacttaggtg 45398975  T
374 ttgaagtttgggagttttattttgaggggtgttcgtt 410  Q
    |||||||||||||||| ||||||| ||||||||||||    
45398976 ttgaagtttgggagttctattttgtggggtgttcgtt 45399012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 193 - 322
Target Start/End: Original strand, 43012374 - 43012503
Alignment:
193 atttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctcttt 292  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |||||||||||||||| | ||||||||||||||||||    
43012374 atttggttctaaagtctggtggcccgatcacttttgattcgagatcgggagtcagttctttgactcaagttggtttttgagcttttgttttgtgctcttt 43012473  T
293 cggtggatcagaggtcgagaggttgtggaa 322  Q
    ||||| ||||||||||| ||||||||||||    
43012474 cggtgaatcagaggtcgcgaggttgtggaa 43012503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 158 - 330
Target Start/End: Original strand, 19176466 - 19176638
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggct 257  Q
    ||||||| ||||||||| | |||||   |||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||    
19176466 ttctctgatgtaccgggagtgagggtgccctgctaatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcagttctttgact 19176565  T
258 caagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatg 330  Q
    |||||||||||||||| ||||| |||||||||||| |||||||| |||||||  ||||||||||| |||||||    
19176566 caagttggtttttgggcttttgatttgtgctcttttggtggatcggaggtcgcaaggttgtggaagctgcatg 19176638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 245 - 412
Target Start/End: Original strand, 21342586 - 21342753
Alignment:
245 cagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagt 344  Q
    ||||||||| || ||| ||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||| ||||||     
21342586 cagctctttagcccaacttggtttttaggcttttgttttgtgctctttcgatggatcagaggtcgagaggttgtggaagctgcttgttcattcggttaga 21342685  T
345 agcttttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttcgtttg 412  Q
    |||||||||   |||||||||||||||||||||||| || ||||||||||   |||||||||||||||    
21342686 agcttttcgaatgtggctcgacttgggtgttgaagtctgagagttttattccaaggggtgttcgtttg 21342753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 160 - 316
Target Start/End: Complemental strand, 2392622 - 2392466
Alignment:
160 ctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctc 258  Q
    |||||||||||||||||||||||||||| || | ||||||| ||| || |||||||||||||||||||||||||||||| || |||||| |||||| ||     
2392622 ctctggtgtaccgggggcgaggggtgccctgctaatttggtactatagcctggtggaccgatcacttttgattcgagattggaagtcagttctttgtctt 2392523  T
259 aagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |||||||||||||||  ||||| |||||||||||||||||||| ||||||| ||||||    
2392522 aagttggtttttggg-ctttgtgttgtgctctttcggtggatcggaggtcgcgaggtt 2392466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 158 - 319
Target Start/End: Complemental strand, 9584171 - 9584009
Alignment:
158 ttctctggtgtaccgggggcgag-gggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttgg 255  Q
    |||||| |||||||||||| ||| ||||||| || | ||||| | ||||||||||||||| ||||||||||||||||||||||||||||||| ||||||     
9584171 ttctcttgtgtaccggggg-gagagggtgccctgctaatttgatactaaagtctggtggatcgatcacttttgattcgagatcgggagtcagttctttgt 9584073  T
256 ctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtg 319  Q
    |||||| ||||||||||| |||||||||||| |||||||||||||| ||||| | |||||||||    
9584072 ctcaagatggtttttgggcttttgttttgtgatctttcggtggatcggaggttgcgaggttgtg 9584009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 158 - 316
Target Start/End: Original strand, 20611746 - 20611904
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||||||||||||||||||||| || | |||| || ||| ||| || ||| ||||||| |||||||||||||||||||||||| |||||| |    
20611746 ttctctggtgtaccgggggcgaggggtgccctgctaatttcgtactatagtttgttgggccgatcatttttgattcgagatcgggagtcagttctttgac 20611845  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    | |||||||||||||||  ||||  |||||||||||||||||||| ||||||| ||||||    
20611846 ttaagttggtttttggg-ctttgcgttgtgctctttcggtggatcggaggtcgcgaggtt 20611904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 158 - 316
Target Start/End: Complemental strand, 34475872 - 34475714
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||||||||||||||||||||| || | ||||| ||||| |||||||||| |||||||||||||||||||||||||||||||  |||| |      
34475872 ttctctggtgtaccgggggcgaggggtgccctgctaatttgtttctatagtctggtgggccgatcacttttgattcgagatcgggagtcaaatcttggaa 34475773  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    | |||||| ||||||||  ||||| |||||||||||||||||||  ||||||| ||||||    
34475772 ttaagttgatttttggg-ctttgtgttgtgctctttcggtggattggaggtcgcgaggtt 34475714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 205 - 316
Target Start/End: Original strand, 17550968 - 17551078
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcaga 304  Q
    |||||||||| |||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||  ||||| ||||||||||||| || ||| ||    
17550968 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctttgactcaagttggtttttggg-ctttgtgttgtgctctttcgatgcatcgga 17551066  T
305 ggtcgagaggtt 316  Q
    ||||| ||||||    
17551067 ggtcgcgaggtt 17551078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 160 - 273
Target Start/End: Complemental strand, 2394369 - 2394255
Alignment:
160 ctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctc 258  Q
    |||||||||||||||||||||||||||| || | ||||||| ||| || |||||||||||||||||||||||||||||| || |||||| |||||| ||     
2394369 ctctggtgtaccgggggcgaggggtgccctgctaatttggtactatagcctggtggaccgatcacttttgattcgagattggaagtcagttctttgtctt 2394270  T
259 aagttggtttttggg 273  Q
    |||||||||||||||    
2394269 aagttggtttttggg 2394255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 155 - 263
Target Start/End: Original strand, 14193900 - 14194009
Alignment:
155 gtgttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctcttt 253  Q
    ||||||| |||||||||||| | |||||||||| |  ||||||||| ||||||||||| ||||||||||||||||||||||||| ||||||| | |||||    
14193900 gtgttctttggtgtaccgggagtgaggggtgcccttctgatttggtcctaaagtctggcggaccgatcacttttgattcgagattgggagtcggttcttt 14193999  T
254 ggctcaagtt 263  Q
    ||||||||||    
14194000 ggctcaagtt 14194009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 204 - 322
Target Start/End: Complemental strand, 33144020 - 33143903
Alignment:
204 aagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaag-ttggtttttgggattttgttttgtgctctttcggtggatca 302  Q
    |||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||| || ||||||||| |||  || ||   |||||||||||||||    
33144020 aagtctggtggatcgatcacttttgattcgagatcgggagtcagttctttggatcaagattagtttttgggcttt--ttatggtttctttcggtggatca 33143923  T
303 gaggtcgagaggttgtggaa 322  Q
    ||||||| ||||| ||||||    
33143922 gaggtcgcgaggtggtggaa 33143903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 191 - 406
Target Start/End: Original strand, 14879432 - 14879646
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctct 290  Q
    ||||| ||| |||||||||||||| |||||||||||||||||||||||||||||| | || |||| |||||||    ||| ||| ||| || ||   |||    
14879432 tgattgggtcctaaagtctggtgggccgatcacttttgattcgagatcgggagtctgttcgttggatcaagttttggttttggacttt-ttatggtttct 14879530  T
291 ttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagcttttcgctcgtggctcgacttgggtgttgaagtttgggagttt 390  Q
    ||||||||||  ||||||||||||| |||||| ||  ||| || ||  | ||| |||||||||   ||||||||  || |||||| |||| |||||||||    
14879531 ttcggtggataggaggtcgagaggtggtggaagcttaatgatctttcagataggagcttttcggatgtggctcgggtttggtgttcaagtctgggagttt 14879630  T
391 tattttgaggggtgtt 406  Q
     |||||||||||||||    
14879631 aattttgaggggtgtt 14879646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 166 - 308
Target Start/End: Original strand, 45163824 - 45163968
Alignment:
166 tgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtg--gaccgatcacttttgattcgagatcgggagtcagctctttggctcaagt 262  Q
    ||||||| |||||||||||||| || | ||||||| ||| ||||| |||  | ||||||||||||||||||||||| | |||||| | |||| || ||||    
45163824 tgtaccgagggcgaggggtgccctgctaatttggtactatagtcttgtgtgggccgatcacttttgattcgagatcagaagtcagttttttgtcttaagt 45163923  T
263 tggtttttgggattttgttttgtgctctttcggtggatcagaggtc 308  Q
    |||||||||||  ||||| |||||||||||||||||||| ||||||    
45163924 tggtttttggg-ctttgtgttgtgctctttcggtggatcggaggtc 45163968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 201 - 278
Target Start/End: Original strand, 47945713 - 47945790
Alignment:
201 ctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggatttt 278  Q
    |||||||| ||||| |||||||||||||||||||||||||||||||| | ||||||||||||| | ||||||| ||||    
47945713 ctaaagtccggtgggccgatcacttttgattcgagatcgggagtcagttatttggctcaagtttgattttgggctttt 47945790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 225 - 316
Target Start/End: Original strand, 47235729 - 47235819
Alignment:
225 tttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    ||||||||||||||| ||||| | |||||| || |||||||||||||||  ||||| || ||||||||||||||||||||||||| ||||||    
47235729 tttgattcgagatcgagagtcggttctttgacttaagttggtttttggg-ctttgtgttttgctctttcggtggatcagaggtcgcgaggtt 47235819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 158 - 278
Target Start/End: Original strand, 37123345 - 37123466
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||| |||||||  || |||||||||| | ||| |||||| ||||| | |||||| |||||||||||||||||||||| ||||||||| |||||||     
37123345 ttctctgatgtaccgaaggagaggggtgcccttatgttttggtcctaaattttggtgggccgatcacttttgattcgagattgggagtcagttctttgga 37123444  T
257 tcaagttggtttttgggatttt 278  Q
    |||| || | ||||||| ||||    
37123445 tcaaatttggttttgggctttt 37123466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 193 - 316
Target Start/End: Original strand, 31482883 - 31483005
Alignment:
193 atttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctcttt 292  Q
    ||||||||||| ||||||| || | ||||||||||||||||||||||||| |||  ||||    | |||||| ||||||||  ||||| |||||||||||    
31482883 atttggttctatagtctggcgggcggatcacttttgattcgagatcgggaatcaaatcttaaaattaagttgatttttggg-ctttgtgttgtgctcttt 31482981  T
293 cggtggatcagaggtcgagaggtt 316  Q
    ||||||||  ||||||| ||||||    
31482982 cggtggattggaggtcgcgaggtt 31483005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 201 - 255
Target Start/End: Complemental strand, 14755339 - 14755285
Alignment:
201 ctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttgg 255  Q
    |||||||||||||| ||||||||||||||||| |||||||||||||| |||||||    
14755339 ctaaagtctggtgggccgatcacttttgattcaagatcgggagtcagttctttgg 14755285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 158 - 263
Target Start/End: Original strand, 25647647 - 25647753
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||||||| | || ||||||| |  ||||||||| ||||||||||  || || ||||||||||||||||||||||||||  | ||||||||    
25647647 ttctctggtgtaccgggagtgaagggtgcccttctgatttggtcctaaagtctgacgggcctatcacttttgattcgagatcgggagttggttctttggc 25647746  T
257 tcaagtt 263  Q
    | |||||    
25647747 ttaagtt 25647753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 191 - 299
Target Start/End: Complemental strand, 1652970 - 1652864
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctct 290  Q
    ||||||||| || || ||| |||| ||||||||||||||||||||||| ||||| || ||||||| ||||||| | ||||||| |||  ||| ||| |||    
1652970 tgatttggtcctgaactcttgtgggccgatcacttttgattcgagatcaggagttagttctttggttcaagtttggttttgggcttt--tttggtgttct 1652873  T
291 ttcggtgga 299  Q
    |||||||||    
1652872 ttcggtgga 1652864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 205 - 263
Target Start/End: Original strand, 5556581 - 5556639
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagtt 263  Q
    ||||||||||  ||||| ||||||||||||||||||||||||| ||||||| |||||||    
5556581 agtctggtggggcgatcgcttttgattcgagatcgggagtcagttctttggttcaagtt 5556639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 209 - 262
Target Start/End: Complemental strand, 39021342 - 39021289
Alignment:
209 tggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagt 262  Q
    |||||| |||||||||||||||||||| ||||||||||| ||||||| ||||||    
39021342 tggtgggccgatcacttttgattcgaggtcgggagtcagttctttggatcaagt 39021289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 204 - 243
Target Start/End: Complemental strand, 20710779 - 20710740
Alignment:
204 aagtctggtggaccgatcacttttgattcgagatcgggag 243  Q
    ||||||||||| ||||||||||||||||||||||||||||    
20710779 aagtctggtgggccgatcacttttgattcgagatcgggag 20710740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 190 - 257
Target Start/End: Complemental strand, 24099412 - 24099345
Alignment:
190 atgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggct 257  Q
    |||||||| || || |||||||||| ||||||||||||||||||| ||||||| |||| | |||||||    
24099412 atgatttgtttatagagtctggtgggccgatcacttttgattcgatatcgggaatcagttttttggct 24099345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 194 - 320
Target Start/End: Original strand, 27398958 - 27399083
Alignment:
194 tttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttc 293  Q
    |||||| | ||||||||||||  | ||| |||| |||||||| || |||||||| | ||||| ||||||| | ||||||| |||| ||| ||| |||||     
27398958 tttggtccgaaagtctggtggcacaatcgctttagattcgaggtcaggagtcagttatttggttcaagtttggttttgggctttt-tttggtgttctttt 27399056  T
294 ggtggatcagaggtcgagaggttgtgg 320  Q
    |||||| ||||||| ||||||| ||||    
27399057 ggtggaccagaggttgagaggtggtgg 27399083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 158 - 263
Target Start/End: Complemental strand, 30935508 - 30935402
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||| ||||||||  ||||||||| |  |||||||||| | |||| |||||| | |||| |||||||||| ||||||||||| || | |||||     
30935508 ttctctggtggaccgggggtaaggggtgcccttctgatttggttttgaagtttggtgggctgatcgcttttgattcaagatcgggagttagttatttggt 30935409  T
257 tcaagtt 263  Q
    |||||||    
30935408 tcaagtt 30935402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 205 - 263
Target Start/End: Original strand, 30127273 - 30127332
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggagtcagctct-ttggctcaagtt 263  Q
    |||||||||  |||||| ||||||||||||||||||||||||| ||| ||| ||||||||    
30127273 agtctggtgagccgatcgcttttgattcgagatcgggagtcagttctcttgactcaagtt 30127332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 257 - 316
Target Start/End: Original strand, 53247963 - 53248021
Alignment:
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |||||||||||||| | ||||||| |||||||||||||||||||  ||||||| ||||||    
53247963 tcaagttggtttttag-attttgtgttgtgctctttcggtggattggaggtcgcgaggtt 53248021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 171 - 247
Target Start/End: Original strand, 31424212 - 31424289
Alignment:
171 cgggggcgaggggtgcctga-tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    |||||| ||||||||||| | ||||||| ||  | |||||||| | ||| || |||||||||||||||||||||||||    
31424212 cgggggtgaggggtgccttactgatttgttttcagagtctggtaggccggtcgcttttgattcgagatcgggagtcag 31424289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 166; Significance: 1e-88; HSPs: 40)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 151 - 407
Target Start/End: Original strand, 34389918 - 34390175
Alignment:
151 tatggtgttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagct 249  Q
    |||||||||||||||||||| ||||| |||| ||||| || |||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||    
34389918 tatggtgttctctggtgtactgggggtgaggagtgccctgctgatttggttttaaagtctggtgggccgatcacttttgattcgagatcgggagtcagct 34390017  T
250 ctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagctt 349  Q
    |||||||| ||||||||||||||| |||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| | |||| |||||    
34390018 ctttggcttaagttggtttttgggcttttattttgtgctctttcggtggatcggaggtcgagaggttgtggaagctgcatgttcattcgattaggagctt 34390117  T
350 ttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttc 407  Q
    |||    ||||||| |||||||||||| ||| ||||||||||||||||||||||||||    
34390118 ttcaaatgtggctcaacttgggtgttgtagtctgggagttttattttgaggggtgttc 34390175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 163 - 331
Target Start/End: Original strand, 6584877 - 6585046
Alignment:
163 tggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaag 261  Q
    ||||||||||| ||||||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||    
6584877 tggtgtaccggaggcgaggggtgccctgctgatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcagctctttggcttaag 6584976  T
262 ttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgt 331  Q
    |||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||    
6584977 ttggtttttgggcttttgttttgtgctctttcggtggatcggaggttgagaggttgtggaacctgcatgt 6585046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 151 - 407
Target Start/End: Complemental strand, 35745952 - 35745690
Alignment:
151 tatggtgttctctggtgtaccgggggcgaggggtgcctga-tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagct 249  Q
    |||||||||||||| ||||||||||||||||||||||  | | |||| ||||||||||||| ||| | ||||||||||||||||||||||| ||||| ||    
35745952 tatggtgttctctgatgtaccgggggcgaggggtgccctactaattttgttctaaagtctgatgggctgatcacttttgattcgagatcggaagtcatct 35745853  T
250 ctttggctcaagttggtttttgggattttg-ttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagct 348  Q
    |||||||||||||||||||||||| ||||| |||||||||||||||||||||  ||||| |||||||||||||| ||||||||||||| |||||| ||||    
35745852 ctttggctcaagttggtttttgggcttttgtttttgtgctctttcggtggattggaggtggagaggttgtggaagctgcatgttcattcggttaggagct 35745753  T
349 tttcg----ctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttc 407  Q
    |||||     | |||||||  ||||||||||||||| ||   ||||||||||||| |||||||    
35745752 tttcgatatatagtggctcagcttgggtgttgaagtctgactgttttattttgagaggtgttc 35745690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 158 - 330
Target Start/End: Complemental strand, 41089866 - 41089693
Alignment:
158 ttctctggtgtaccgggggcgaggggtgc-ctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||| |||||||||||||||| ||| | ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |    
41089866 ttctctggtgtatcgggggcgaggggtgctctgctaatttggtactaaagtctggtggaccgatcacttttgattcgagattgggagtcagctctttgac 41089767  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatg 330  Q
    ||||||||||||||| | |||||||||||| |||||||||||||| ||||||| |||||||||||| |||||||    
41089766 tcaagttggtttttgagcttttgttttgtgatctttcggtggatcggaggtcgcgaggttgtggaagctgcatg 41089693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 158 - 401
Target Start/End: Original strand, 3867079 - 3867324
Alignment:
158 ttctctggtgtaccgggggcgaggggtg-cctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||||| |||||| ||||| |||| | ||||||| ||||| | |||||| | ||||||||||||||||||| |||||||||| |||||| |    
3867079 ttctctggtgtaccgagggcgaagggtggcctgctaatttggtactaaaatatggtgggctgatcacttttgattcgagaccgggagtcagttctttgac 3867178  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagcttttcgct- 355  Q
    ||||||||||||||||| ||||| ||||||||||| ||||||||||||||||| |||||| ||||||||||||| || |||||| ||  ||| |||| |     
3867179 tcaagttggtttttgggcttttgctttgtgctcttgcggtggatcagaggtcgcgaggttatggaaactgcatgatcctttggtcaggtgctcttcgata 3867278  T
356 cgtggctcgacttgggtgttgaagtttgggagttttattttgaggg 401  Q
     |||||||  ||||||||||| ||| ||| ||||||||||||||||    
3867279 tgtggctcagcttgggtgttggagtatggaagttttattttgaggg 3867324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 153 - 319
Target Start/End: Original strand, 33435067 - 33435234
Alignment:
153 tggtgttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctct 251  Q
    |||| |||||||||||||||||||||||||||||| || | ||||||| |||||||||||||   ||||||||||||||||||||||||||||||| |||    
33435067 tggttttctctggtgtaccgggggcgaggggtgccctgttaatttggtactaaagtctggtgagacgatcacttttgattcgagatcgggagtcagttct 33435166  T
252 ttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtg 319  Q
    ||| |||||||| |||| ||||  |||||||||||||||||||||||||| ||||||| |||||||||    
33435167 ttgtctcaagttcgtttgtgggcatttgttttgtgctctttcggtggatcggaggtcgcgaggttgtg 33435234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 158 - 308
Target Start/End: Complemental strand, 3419774 - 3419623
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||| |||||||||||||||||||| || | ||||||| ||||||| |||||| | ||||||||||||||||||||||||||||||||||||| |    
3419774 ttctctggtataccgggggcgaggggtgccctgttaatttggtactaaagtgtggtgggctgatcacttttgattcgagatcgggagtcagctctttgac 3419675  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtc 308  Q
    ||||||||||||||||| |||  || ||||||||||||||||||||||||||    
3419674 tcaagttggtttttgggctttgtttctgtgctctttcggtggatcagaggtc 3419623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 158 - 316
Target Start/End: Complemental strand, 47326003 - 47325845
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcct-gatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||||||||||||||||||||| | | ||||||| ||| |||||||||| |||||| ||||||||| |||||||||||||||||||||| |    
47326003 ttctctggtgtaccgggggcgaggggtgccttgctaatttggtactatagtctggtgggccgatcgcttttgatttgagatcgggagtcagctctttgac 47325904  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |||||||||||||||||  |||||  |||||||||||| |||||| ||||||| ||||||    
47325903 tcaagttggtttttggg-ctttgtgctgtgctctttcgatggatcggaggtcgcgaggtt 47325845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 218 - 412
Target Start/End: Complemental strand, 48162083 - 48161890
Alignment:
218 gatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgtttt-gtgctctttcggtggatcagaggtcgagaggtt 316  Q
    ||||| ||||||||||||||||| | |||| |||||||||||| ||| |||||||  ||||||||| ||||||||| |||||||||||||||||||||||    
48162083 gatcatttttgattcgagatcggaaatcagttctttggctcaaattgatttttggacttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 48161984  T
317 gtggaaactgcatgttcatttggttagtagcttttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttcgtttg 412  Q
    ||||||  ||| |||||||| |||||| |||||||||   |||||||||||| || |||||||| || |||||||||| |||| ||||||||||||    
48161983 gtggaagttgcttgttcattgggttag-agcttttcgaatgtggctcgactt-ggcgttgaagtctgagagttttattctgagaggtgttcgtttg 48161890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 158 - 316
Target Start/End: Original strand, 38306224 - 38306382
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||| |||||||||||||||| || | ||||||| ||| |||||||||| |||||||||||||||||||||| ||||||||| |||||| |    
38306224 ttctctggtgtacagggggcgaggggtgccctgctaatttggtactatagtctggtgggccgatcacttttgattcgagattgggagtcagttctttgac 38306323  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |||||||||||||||||  ||||| ||||||||||||| ||| || ||||||| ||||||    
38306324 tcaagttggtttttggg-ctttgtgttgtgctctttcgatggttcggaggtcgcgaggtt 38306382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 158 - 406
Target Start/End: Original strand, 8745116 - 8745363
Alignment:
158 ttctctggtgtaccgggggcgaggggtg-cctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||| |||| ||| |||||||| |||  ||||||||| ||||| |||||||| ||||||||||||||||||||||||||| |||| || ||||     
8745116 ttctctggtgcaccgagggtgaggggtggccttctgatttggtcctaaattctggtgggccgatcacttttgattcgagatcgggattcagttcgttgga 8745215  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagcttttcgctc 356  Q
    ||||||| | ||||||| |||  || ||   |||||||||||||| |||||||||||||||||||| ||||||| || ||  | ||| |||||||||       
8745216 tcaagtttggttttgggcttt--ttatggtttctttcggtggatcggaggtcgagaggttgtggaagctgcatgatctttcagataggagcttttcggat 8745313  T
357 gtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgtt 406  Q
    |||||||  ||| |||||| |||  ||||||||| |||||||||||||||    
8745314 gtggctcagctttggtgttcaagactgggagtttaattttgaggggtgtt 8745363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 163 - 401
Target Start/End: Original strand, 37794957 - 37795197
Alignment:
163 tggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaag 261  Q
    ||||||||||||||||||||||||| || | |||||||  || ||| |||||| ||| ||| |||||||||||||||||||||||| ||||||  |||||    
37794957 tggtgtaccgggggcgaggggtgccctgctaatttggtaatatagtatggtgggccgttcagttttgattcgagatcgggagtcagttctttgagtcaag 37795056  T
262 ttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagagg-ttgtggaaactgcatgttcatttggttagtagcttttcgctc-gtg 359  Q
    ||||||||||||  ||||| ||||||||||||||||| || ||||||| |||| |||||  | ||||||| || || ||||||  ||| ||||  | |||    
37795057 ttggtttttggg-ctttgtgttgtgctctttcggtggttcggaggtcgcgaggtttgtgatagctgcatgatccttcggttaggtgctcttcgaactgtg 37795155  T
360 gctcgacttgggtgttgaagtttgggagttttattttgaggg 401  Q
    ||||  |||||||||||  ||||| |||||||||||||||||    
37795156 gctcagcttgggtgttggggtttgagagttttattttgaggg 37795197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 158 - 316
Target Start/End: Original strand, 10244145 - 10244303
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||||||||| |||||||||| || | ||||||| ||| | |||||||| |||||||||||||||||||||||||||||||| |||||| |    
10244145 ttctctggtgtaccgggggagaggggtgccctgctaatttggtgctataatctggtgggccgatcacttttgattcgagatcgggagtcagttctttgac 10244244  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    ||||||| |||||| ||  ||||| |||||||||||| |||| || ||||||| ||||||    
10244245 tcaagttagttttt-ggcctttgtgttgtgctctttcagtggttcggaggtcgcgaggtt 10244303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 166 - 316
Target Start/End: Complemental strand, 5860398 - 5860248
Alignment:
166 tgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttg 264  Q
    |||||||||||||||||||||| || | ||||||| ||| |||| ||||| || ||| ||||||||||||||||||||||||  |||||| | |||||||    
5860398 tgtaccgggggcgaggggtgccctgctaatttggtactatagtccggtgggcctatcgcttttgattcgagatcgggagtcaattctttgacgcaagttg 5860299  T
265 gtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |||||||||  ||||| ||||||||||||||||| || ||||||| ||||||    
5860298 gtttttggg-ctttgtgttgtgctctttcggtggttcggaggtcgcgaggtt 5860248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 158 - 300
Target Start/End: Original strand, 25160778 - 25160918
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||||| |||||||||||||| || | ||||||||||| |||||||||||||||| ||||||||||||||||||| |||||  ||||        
25160778 ttctctggtgtaccgagggcgaggggtgccctgctaatttggttctatagtctggtggaccgattacttttgattcgagatcggaagtcaaatcttgaaa 25160877  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggat 300  Q
    | |||||||||||||||    ||| |||||||||||||||||||    
25160878 ttaagttggtttttggg---ctgtgttgtgctctttcggtggat 25160918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 216 - 316
Target Start/End: Complemental strand, 44353623 - 44353524
Alignment:
216 ccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggt 315  Q
    |||||||||||||||| ||||||||||||||| |||||| || | |||||||||||||  ||||| |||||||||||||||||||| ||||||| |||||    
44353623 ccgatcacttttgatttgagatcgggagtcagttctttgacttatgttggtttttggg-ctttgtgttgtgctctttcggtggatcggaggtcgcgaggt 44353525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 158 - 406
Target Start/End: Complemental strand, 24324916 - 24324668
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||| |||||||||||||   ||||||||| |  |||||||||  |||||| |||||| ||||||| |||||||||||||||||||||||  ||||||||    
24324916 ttctttggtgtaccggggtttaggggtgcccttctgatttggtcttaaagtttggtgggccgatcaattttgattcgagatcgggagtcaattctttggc 24324817  T
257 tcaag-ttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagcttttcgct 355  Q
    ||||| || | ||||||| |||  || ||   ||||| |||||||| ||||||||| ||| |||||| ||| ||| || || |||||| |||||||||      
24324816 tcaagttttggttttgggcttt--ttatggtttctttaggtggatcggaggtcgaggggtggtggaagctgaatgatctttcggttaggagcttttcggc 24324719  T
356 cgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgtt 406  Q
     |||||||  ||| |||||| | |   | ||||||||||||||||||||||    
24324718 tgtggctcagctttggtgttcaggacggagagttttattttgaggggtgtt 24324668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 158 - 326
Target Start/End: Complemental strand, 42533370 - 42533204
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||| | |||||| |||||||||| |  ||||||||| |||||||||||||| | |||||||||||||||||||||||||||||   |||||||    
42533370 ttctctggtgcatcgggggtgaggggtgccctcctgatttggtcctaaagtctggtgggctgatcacttttgattcgagatcgggagtcaatcctttggc 42533271  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactg 326  Q
    | ||||| |  |||||| |||  || ||   |||||||||||||||||||||| ||||| |||| |||||    
42533270 ttaagtttg-gtttgggcttt--ttatggtttctttcggtggatcagaggtcgtgaggtggtggcaactg 42533204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 158 - 314
Target Start/End: Original strand, 1320757 - 1320913
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||| |||| |||||| |||||||||| |  |||||||||  ||||||||||||| ||||||||||||||||| | ||||| |||||| ||||||||    
1320757 ttctctgatgtatcgggggtgaggggtgcccttttgatttggtcataaagtctggtgggccgatcacttttgattcaaaatcggaagtcagttctttggc 1320856  T
257 tcaag-ttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagagg 314  Q
    ||||| || | ||||||| |||  || ||   |||||||||||||| ||||||||||||    
1320857 tcaagttttggttttgggcttt--ttatggtttctttcggtggatcggaggtcgagagg 1320913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 194 - 315
Target Start/End: Original strand, 3478352 - 3478471
Alignment:
194 tttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttc 293  Q
    |||||| ||||||| |||||| ||||||||||||||||||||||||||||| || ||||||||||||| |   ||||||| |||   || ||| ||||||    
3478352 tttggtcctaaagtttggtgggccgatcacttttgattcgagatcgggagttagttctttggctcaagattagttttgggcttt--gttggtgttctttc 3478449  T
294 ggtggatcagaggtcgagaggt 315  Q
    |||||||| ||| |||||||||    
3478450 ggtggatcggagatcgagaggt 3478471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 158 - 263
Target Start/End: Complemental strand, 6716854 - 6716748
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||||| | | |||||||||| |  ||||||  |  ||||||||||| | |||||||||||||||||||||||||||||||| ||||||||    
6716854 ttctctggtgtaccgagagtgaggggtgcccttctgatttaatcataaagtctggttggccgatcacttttgattcgagatcgggagtcagttctttggc 6716755  T
257 tcaagtt 263  Q
    |||||||    
6716754 tcaagtt 6716748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 205 - 263
Target Start/End: Original strand, 13311850 - 13311908
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagtt 263  Q
    |||||||||| |||||||||||||||||||||||||||||||| ||||||| |||||||    
13311850 agtctggtgggccgatcacttttgattcgagatcgggagtcagttctttggttcaagtt 13311908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 158 - 263
Target Start/End: Original strand, 16954616 - 16954722
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||| | | || |||||||||| |  ||||||||| |||||||||||| ||||||||||||||| ||||||||||  |||||| |||||| |    
16954616 ttctctggtgtatcagaggtgaggggtgcccttctgatttggtcctaaagtctggttgaccgatcacttttgtttcgagatcgaaagtcagttctttgac 16954715  T
257 tcaagtt 263  Q
    |||||||    
16954716 tcaagtt 16954722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 191 - 272
Target Start/End: Original strand, 12480883 - 12480965
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaag-ttggtttttgg 272  Q
    |||||| || || |||| |||||| |||||| ||||||||||||||||||||||||| ||||||| ||||| |||||||||||    
12480883 tgattttgtcctgaagtttggtgggccgatcgcttttgattcgagatcgggagtcagttctttggttcaagtttggtttttgg 12480965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 150 - 283
Target Start/End: Original strand, 23983150 - 23983284
Alignment:
150 ttatggtgttct-ctggtgtaccgggggcgaggggtgcctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagc 248  Q
    |||||||||||| |||||| |||| ||| |||||||||||  | |||||||  | |||||||||||  |||||  |||||||||||||||||||||||      
23983150 ttatggtgttcttctggtggaccgagggtgaggggtgccttctaatttggtcttgaagtctggtgggtcgatcgtttttgattcgagatcgggagtcaat 23983249  T
249 tctttggctcaagttggtttttgggattttgtttt 283  Q
    || || ||||||||| | ||||||| |||| ||||    
23983250 tccttagctcaagtttggttttgggtttttttttt 23983284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 158 - 247
Target Start/End: Original strand, 38485519 - 38485609
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    |||||||||| || |||||  ||||||||| |  ||| || ||||| ||||||||||| ||||||||||||||||||||||||||||||||    
38485519 ttctctggtggactgggggtaaggggtgcccttctgaatttgttctgaagtctggtgggccgatcacttttgattcgagatcgggagtcag 38485609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 158 - 263
Target Start/End: Complemental strand, 47457140 - 47457034
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcctga-tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||| | ||||||  ||||||||| |  ||||| ||| || ||||||| |||||||||| ||||||||| ||||| ||||||||| ||||||||    
47457140 ttctctggtggatcgggggtaaggggtgcccgtctgattaggtcctgaagtctgatggaccgatcgcttttgatttgagattgggagtcagttctttggc 47457041  T
257 tcaagtt 263  Q
    |||||||    
47457040 tcaagtt 47457034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 191 - 299
Target Start/End: Complemental strand, 46133362 - 46133254
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaag-ttggtttttgggattttgttttgtgctc 289  Q
    ||||||||| || ||||||||||  |||||| ||||||||| ||||||||||||||| ||| ||| ||||| |||||||||||| |||| ||| ||| ||    
46133362 tgatttggtgctgaagtctggtgagccgatcgcttttgatttgagatcgggagtcagttctctggttcaagtttggtttttgggctttt-tttggtgttc 46133264  T
290 tttcggtgga 299  Q
     |||||||||    
46133263 cttcggtgga 46133254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 202 - 246
Target Start/End: Original strand, 9349757 - 9349801
Alignment:
202 taaagtctggtggaccgatcacttttgattcgagatcgggagtca 246  Q
    ||||||||||||| |||||||||||||||||||||||||||||||    
9349757 taaagtctggtgggccgatcacttttgattcgagatcgggagtca 9349801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 158 - 263
Target Start/End: Complemental strand, 16829054 - 16828948
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||| ||||| | |||| |||||||||| |  ||||||||| |||||||||||| | | ||||||||||| ||||||||||  |||||| |||||| |    
16829054 ttctctagtgtatcaggggtgaggggtgcccttctgatttggtcctaaagtctggttggctgatcacttttgtttcgagatcgaaagtcagttctttgac 16828955  T
257 tcaagtt 263  Q
    |||||||    
16828954 tcaagtt 16828948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 205 - 243
Target Start/End: Complemental strand, 27993606 - 27993568
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggag 243  Q
    |||||||||||||||||||||||||||||||||||||||    
27993606 agtctggtggaccgatcacttttgattcgagatcgggag 27993568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 357 - 404
Target Start/End: Original strand, 6585045 - 6585092
Alignment:
357 gtggctcgacttgggtgttgaagtttgggagttttattttgaggggtg 404  Q
    |||||||  ||||||||||||||| |||||||||||||||||||||||    
6585045 gtggctcagcttgggtgttgaagtctgggagttttattttgaggggtg 6585092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 205 - 263
Target Start/End: Complemental strand, 11379197 - 11379139
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagtt 263  Q
    |||||||||  |||||| |||||||||||||||||||||||||  |||||| |||||||    
11379197 agtctggtgagccgatcgcttttgattcgagatcgggagtcagtactttggttcaagtt 11379139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 205 - 239
Target Start/End: Original strand, 25153231 - 25153265
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcg 239  Q
    |||||||||||||||||||||||||||||||||||    
25153231 agtctggtggaccgatcacttttgattcgagatcg 25153265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 158 - 231
Target Start/End: Original strand, 44755590 - 44755663
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgatt 231  Q
    ||||||||||||||| ||  |||||||||| |  ||||||||| |||||||||||||| ||||||||||||||||    
44755590 ttctctggtgtaccgtggt-gaggggtgcccttctgatttggtcctaaagtctggtgggccgatcacttttgatt 44755663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 205 - 243
Target Start/End: Complemental strand, 46262189 - 46262151
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggag 243  Q
    |||||||||| ||||||||||||||||||||||||||||    
46262189 agtctggtgggccgatcacttttgattcgagatcgggag 46262151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 254
Target Start/End: Complemental strand, 17802885 - 17802837
Alignment:
206 gtctggtggaccgatcacttttgattcgagatcgggagtcagctctttg 254  Q
    ||||||||| ||||||||||||||||||||||||| || ||||| ||||    
17802885 gtctggtgggccgatcacttttgattcgagatcggaagccagctttttg 17802837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 204 - 272
Target Start/End: Complemental strand, 48058725 - 48058657
Alignment:
204 aagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgg 272  Q
    |||||||||||  ||||| ||||||||| |||||||| |||||| | ||||||||||||| | ||||||    
48058725 aagtctggtgggtcgatcgcttttgatttgagatcggaagtcagttttttggctcaagtttggttttgg 48058657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 205 - 263
Target Start/End: Complemental strand, 1820072 - 1820014
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagtt 263  Q
    |||||||||||||||||  |||||||||||||| ||||||||  ||||||  |||||||    
1820072 agtctggtggaccgatcgattttgattcgagatagggagtcaaatctttgattcaagtt 1820014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 205 - 243
Target Start/End: Complemental strand, 35206763 - 35206725
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggag 243  Q
    |||||||||| ||||||||||||||| ||||||||||||    
35206763 agtctggtgggccgatcacttttgatccgagatcgggag 35206725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 166; Significance: 1e-88; HSPs: 34)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 151 - 407
Target Start/End: Complemental strand, 27031965 - 27031708
Alignment:
151 tatggtgttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagct 249  Q
    ||||||||||||||||||||||||||  ||||||||| || ||||||||||||||||||| |||| |||||||||||||||||||||||| |||||||||    
27031965 tatggtgttctctggtgtaccgggggaaaggggtgccctgctgatttggttctaaagtctagtgggccgatcacttttgattcgagatcgagagtcagct 27031866  T
250 ctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagctt 349  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||| |||||  |||||    
27031865 ctttggctcaagttggttttagggattttgttttgtgctctttcggtggatcggaggttgagaggttgtggaagctgcatgttcattcggttaagagctt 27031766  T
350 ttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttc 407  Q
    ||||   |||||||   |||| ||||||||| ||||||||||||||||||||||||||    
27031765 ttcgaatgtggctcagtttggatgttgaagtctgggagttttattttgaggggtgttc 27031708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 151 - 406
Target Start/End: Complemental strand, 46814592 - 46814336
Alignment:
151 tatggtgttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagct 249  Q
    ||||||||||||||||||||||||||| ||||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
46814592 tatggtgttctctggtgtaccgggggcaaggggtgccctgctgatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcagct 46814493  T
250 ctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagctt 349  Q
     |||||||||||||||||||| || ||||||||||||||||||||||||||| || ||||||||||||  ||| ||||| ||||||| | |||| |||||    
46814492 ttttggctcaagttggttttttggcttttgttttgtgctctttcggtggatcggatgtcgagaggttgcagaagctgcaagttcattcgattaggagctt 46814393  T
350 ttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgtt 406  Q
    ||||   |||||||| | ||||||||||||| |||||||||||||| ||||||||||    
46814392 ttcgaatgtggctcggcgtgggtgttgaagtatgggagttttatttcgaggggtgtt 46814336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 151 - 406
Target Start/End: Original strand, 24658885 - 24659140
Alignment:
151 tatggtgttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagct 249  Q
    ||||||||||||||||||| ||||||| ||||||||| || |||||||||||||||||||||||| || |||||||||||||||||||||||||||||||    
24658885 tatggtgttctctggtgtatcgggggcaaggggtgccctgctgatttggttctaaagtctggtgggccaatcacttttgattcgagatcgggagtcagct 24658984  T
250 ctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagctt 349  Q
    |||||||| ||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||| |  |||||||||| |||||| |||||    
24658985 ctttggctgaagttggtttttgggctttggttttgtgctctttcggtggatcggaggtcgagaggttgtggaagcatcatgttcattcggttagaagctt 24659084  T
350 ttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgtt 406  Q
    ||||   |||||||  | |||| ||| |||| |||||||||||||||||||||||||    
24659085 ttcgaatgtggctcagcctgggagtt-aagtctgggagttttattttgaggggtgtt 24659140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 151 - 407
Target Start/End: Original strand, 7857609 - 7857866
Alignment:
151 tatggtgttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagct 249  Q
    |||| ||||||||||||||| |||||||||||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||    
7857609 tatgttgttctctggtgtactgggggcgaggggtgccctgctgatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcaact 7857708  T
250 ctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagctt 349  Q
    |||| ||| ||||||||||||||  ||||||||||||||||||||||||||| | |||||||||||||||||| |||| ||| |||| |||||| |||||    
7857709 cttttgctgaagttggtttttggccttttgttttgtgctctttcggtggatcggtggtcgagaggttgtggaagctgcttgtccattcggttaggagctt 7857808  T
350 ttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttc 407  Q
    ||     |||||||   |||||||||||||| ||||||||||||||||||||||||||    
7857809 ttgaaatgtggctcagtttgggtgttgaagtctgggagttttattttgaggggtgttc 7857866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 153 - 322
Target Start/End: Complemental strand, 24684601 - 24684431
Alignment:
153 tggtgttctctggtgtaccgggggcgaggggtgcctga-tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctct 251  Q
    |||| ||||||||||||||||||||||||||||||  | | ||||| |||||||||||||||| |||||||||||| ||||||||||||  ||||| |||    
24684601 tggttttctctggtgtaccgggggcgaggggtgccctactaatttgattctaaagtctggtgggccgatcacttttaattcgagatcggatgtcagttct 24684502  T
252 ttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaa 322  Q
    ||| ||| |||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||    
24684501 ttgactctagttggtttttgggcttttgttttgtgctctttcggtggatcggaggtcgcgaggttgtggaa 24684431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 158 - 316
Target Start/End: Complemental strand, 46692937 - 46692779
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||||||||||||| |||||| || | |||||||  || |||||||||| ||||||||||||||||||||||||||||| || ||||||||    
46692937 ttctctggtgtaccgggggcgagaggtgccctgctaatttggtgatatagtctggtgggccgatcacttttgattcgagatcgggagttagttctttggc 46692838  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |||||||||||||||||  ||||| ||||||||||||||||| || ||||||| ||||||    
46692837 tcaagttggtttttggg-ctttgtgttgtgctctttcggtggttcggaggtcgcgaggtt 46692779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 158 - 316
Target Start/End: Original strand, 41920416 - 41920573
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||| |||| ||||||||||| || | ||||||| ||| |||||||||| |||||||||||||||||||||||||||||||| |||||| |    
41920416 ttctctggtgtactgggg-cgaggggtgccctgctaatttggtactacagtctggtgggccgatcacttttgattcgagatcgggagtcagttctttgac 41920514  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    ||||||||| |||||||  ||||| |||||||||||||||||||| ||||||| ||||||    
41920515 tcaagttggattttggg-ctttgtgttgtgctctttcggtggatcggaggtcgcgaggtt 41920573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 158 - 316
Target Start/End: Complemental strand, 5389539 - 5389381
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcct-gatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||||||||||||||||||||  | | ||||||| ||| ||||||  || |||||||||||||||||||||||||||||||| |||||| |    
5389539 ttctctggtgtaccgggggcgaggggtgcccagctaatttggtactatagtctgaagggccgatcacttttgattcgagatcgggagtcagttctttgac 5389440  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    ||||||| |||||||||  ||||| ||||||||||||||||| || ||||||| ||||||    
5389439 tcaagtttgtttttggg-ctttgtgttgtgctctttcggtggttcggaggtcgcgaggtt 5389381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 158 - 316
Target Start/End: Complemental strand, 24450048 - 24449890
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||||||||||||||||||||| || |  |||||| ||| ||| |||||| |||||||||||||||| |||||||| |||||| |||||| |    
24450048 ttctctggtgtaccgggggcgaggggtgccctgctattttggtactatagtttggtgggccgatcacttttgatttgagatcggaagtcagttctttgtc 24449949  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    | |||||||||||||||| ||||| ||||||||||| |||||||| ||||||| ||||||    
24449948 ttaagttggtttttggga-tttgtgttgtgctcttttggtggatcggaggtcgcgaggtt 24449890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 158 - 316
Target Start/End: Complemental strand, 30686022 - 30685864
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||||| ||||||||||||||| || | ||||||| ||| ||||| |||| |||||||||||||||| ||||||||||||||| |||||| |    
30686022 ttctctggtgtacctggggcgaggggtgccctgctaatttggtactatagtcttgtgggccgatcacttttgatttgagatcgggagtcagttctttgac 30685923  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    ||||||||| |||||||  ||||| ||||||||||||||||| || ||||||| ||||||    
30685922 tcaagttggcttttggg-ctttgtgttgtgctctttcggtggttcggaggtcgcgaggtt 30685864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 158 - 316
Target Start/End: Complemental strand, 31585878 - 31585720
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||| | ||| |||||||||| || | ||||||| ||| |||||||||| |||||||||||||||||||||||||||||||| |||||| |    
31585878 ttctctggtgtactgagggtgaggggtgccctgctaatttggtactatagtctggtgggccgatcacttttgattcgagatcgggagtcagttctttgac 31585779  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |||||||||||||||||  ||||| ||||||| ||||||||| || ||||||| ||||||    
31585778 tcaagttggtttttggg-ctttgtgttgtgctatttcggtgggtcggaggtcgcgaggtt 31585720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 167 - 316
Target Start/End: Original strand, 5459133 - 5459282
Alignment:
167 gtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttgg 265  Q
    |||||||||||||||||| || || | ||||||| ||| |||||||||| |||||||||||||||||||||||||||||||  | ||||  ||||||||     
5459133 gtaccgggggcgaggggtaccctgctaatttggtgctatagtctggtgggccgatcacttttgattcgagatcgggagtcaattatttgattcaagttga 5459232  T
266 tttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    ||||||||  ||||| |||||||||||| |||| || ||||| | ||||||    
5459233 tttttggg-ctttgtgttgtgctctttcagtggttcggaggttgcgaggtt 5459282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 191 - 295
Target Start/End: Original strand, 17033583 - 17033687
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaag-ttggtttttgggattttgttttgtgctc 289  Q
    ||||||||| ||| |||||||||| |||||||||||||| ||||||||||||||||| ||||||| ||||| || | ||||||| |||| ||||||| ||    
17033583 tgatttggtcctatagtctggtgggccgatcacttttgaatcgagatcgggagtcagttctttggttcaagttttggttttgggctttt-ttttgtgttc 17033681  T
290 tttcgg 295  Q
    ||||||    
17033682 tttcgg 17033687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 191 - 255
Target Start/End: Complemental strand, 6583300 - 6583236
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttgg 255  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||| |||||  |||||||    
6583300 tgatttggtcctaaagtctggtggaccgatcacttttgattcgagatcggcagtcaattctttgg 6583236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 158 - 257
Target Start/End: Complemental strand, 9313407 - 9313307
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||| ||||| |||| | |||||||||| |  ||||||||| ||||||||| |||| | |||||||||||||||||||||||||||||| ||||||||    
9313407 ttctctcgtgtatcgggcgtgaggggtgcccttctgatttggtcctaaagtctagtgggctgatcacttttgattcgagatcgggagtcagttctttggc 9313308  T
257 t 257  Q
    |    
9313307 t 9313307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 216 - 322
Target Start/End: Original strand, 27102213 - 27102317
Alignment:
216 ccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggt 315  Q
    |||||||||||||||||||||||||||||||| ||||||| ||||||| | ||||||| |||  ||  |   |||||||||||||| |||||||||||||    
27102213 ccgatcacttttgattcgagatcgggagtcagttctttggatcaagtttggttttgggcttt--ttacggtttctttcggtggatcggaggtcgagaggt 27102310  T
316 tgtggaa 322  Q
     ||||||    
27102311 ggtggaa 27102317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 158 - 274
Target Start/End: Complemental strand, 20113639 - 20113522
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||| |||||||||||||||||||||||| || | |||||||  || |||||| |||  |||||| ||||||||| ||||||||| |||| |||||  |    
20113639 ttctcgggtgtaccgggggcgaggggtgccctgctaatttggtattatagtctgctgggacgatcatttttgattcaagatcgggaatcagttctttaac 20113540  T
257 tcaagttggtttttggga 274  Q
    | ||||||||||||||||    
20113539 ttaagttggtttttggga 20113522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 158 - 247
Target Start/End: Original strand, 4651743 - 4651833
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    |||||||||||||||||||  ||||||||| |  ||| || ||||  |||||||| || ||||||||||||||||||||||||||||||||    
4651743 ttctctggtgtaccgggggtaaggggtgcccttctgaatttgttccgaagtctggggggccgatcacttttgattcgagatcgggagtcag 4651833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 204 - 278
Target Start/End: Original strand, 19598646 - 19598720
Alignment:
204 aagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggatttt 278  Q
    ||||||||||| |||||| ||||||||||||||||| ||||||| |||||| |||||||| | ||||||| ||||    
19598646 aagtctggtgggccgatcgcttttgattcgagatcgagagtcagttctttgactcaagtttgattttgggttttt 19598720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 191 - 263
Target Start/End: Original strand, 34774868 - 34774940
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcag-ctctttggctcaagtt 263  Q
    ||||||||| |||| |||||||||||||||||||||||| |||||||||||||||||  | |||||||||||||    
34774868 tgatttggtcctaacgtctggtggaccgatcacttttga-tcgagatcgggagtcagtttttttggctcaagtt 34774940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 178 - 255
Target Start/End: Complemental strand, 38544835 - 38544758
Alignment:
178 gaggggtgcctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttgg 255  Q
    ||||||| |||  |||||||||  | ||||||||||| |||||| ||||||||||||||||||||||||| |||||||    
38544835 gaggggtcccttctgatttggtcatgaagtctggtgggccgatcgcttttgattcgagatcgggagtcagttctttgg 38544758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 192 - 247
Target Start/End: Complemental strand, 15840995 - 15840940
Alignment:
192 gatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    |||||| ||||| |||||||||| | ||||||||||||||||||||||||||||||    
15840995 gatttgtttctagagtctggtgggctgatcacttttgattcgagatcgggagtcag 15840940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 192 - 278
Target Start/End: Complemental strand, 32864644 - 32864558
Alignment:
192 gatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggatttt 278  Q
    |||||||| |||||| ||||||| || ||||||||| |||||||||||| |||| | |||||| |||||||| | ||||||| ||||    
32864644 gatttggtcctaaaggctggtgggccaatcacttttaattcgagatcggaagtcggttctttgactcaagtttggttttgggctttt 32864558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 193 - 238
Target Start/End: Original strand, 27905411 - 27905456
Alignment:
193 atttggttctaaagtctggtggaccgatcacttttgattcgagatc 238  Q
    |||||| | |||||||||||||||||||||||||||||||||||||    
27905411 atttgggtttaaagtctggtggaccgatcacttttgattcgagatc 27905456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 206 - 247
Target Start/End: Original strand, 42374175 - 42374216
Alignment:
206 gtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    |||||||||||||||| ||||||||| |||||||||||||||    
42374175 gtctggtggaccgatcgcttttgatttgagatcgggagtcag 42374216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 207 - 247
Target Start/End: Original strand, 42374049 - 42374089
Alignment:
207 tctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    |||||||||||| | ||||||||||||||||||||||||||    
42374049 tctggtggaccggttacttttgattcgagatcgggagtcag 42374089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 204 - 307
Target Start/End: Complemental strand, 50589278 - 50589177
Alignment:
204 aagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcag 303  Q
    ||||| ||||| | |||| |||||||||||| |||||||| ||| |||||||| |||||| | |||||||   || ||| ||| |||||||||||| |||    
50589278 aagtccggtgggctgatcgcttttgattcgaaatcgggagccagttctttggcccaagtttggttttggg--cttatttagtgttctttcggtggaccag 50589181  T
304 aggt 307  Q
    ||||    
50589180 aggt 50589177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 190 - 269
Target Start/End: Original strand, 2877633 - 2877711
Alignment:
190 atgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttt 269  Q
    ||||||||||| | |||| |||||| |||||| | |||||||| |||| ||||| ||| |||||| ||||||||||||||    
2877633 atgatttggttttgaagtttggtgggccgatcgcatttgattcaagattgggagccag-tctttgactcaagttggtttt 2877711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 10785510 - 10785456
Alignment:
224 ttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggatttt 278  Q
    ||||| |||||||||||||||||| | ||||||||||||| | ||||||| ||||    
10785510 ttttgcttcgagatcgggagtcagttgtttggctcaagtttggttttgggctttt 10785456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 205 - 243
Target Start/End: Original strand, 17891522 - 17891560
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggag 243  Q
    |||||| |||||||||||||||||||||||||| |||||    
17891522 agtctgatggaccgatcacttttgattcgagattgggag 17891560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 205 - 247
Target Start/End: Original strand, 30655571 - 30655613
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    ||||| |||| |||||| |||||||||||||||||||||||||    
30655571 agtctagtgggccgatcgcttttgattcgagatcgggagtcag 30655613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 209 - 238
Target Start/End: Complemental strand, 18787270 - 18787241
Alignment:
209 tggtggaccgatcacttttgattcgagatc 238  Q
    ||||||||||||||||||||||||||||||    
18787270 tggtggaccgatcacttttgattcgagatc 18787241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 205 - 246
Target Start/End: Original strand, 22200019 - 22200060
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggagtca 246  Q
    |||||| ||||||||||||||||||||| |||||| ||||||    
22200019 agtctgatggaccgatcacttttgattcaagatcgagagtca 22200060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 211 - 243
Target Start/End: Complemental strand, 9081569 - 9081537
Alignment:
211 gtggaccgatcacttttgattcgagatcgggag 243  Q
    ||||| |||||||||||||||||||||||||||    
9081569 gtggatcgatcacttttgattcgagatcgggag 9081537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 163; Significance: 6e-87; HSPs: 28)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 151 - 412
Target Start/End: Complemental strand, 15821504 - 15821242
Alignment:
151 tatggtgttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagct 249  Q
    |||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||    
15821504 tatggtgttctctggtgtaccgagggcgaggggtgccctgctgatttggttctaaagtctggtgggctgatcacttttgattcgagatcgggagtcagct 15821405  T
250 ctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagctt 349  Q
    ||||| || | ||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||  | ||||||||||||||| |||||    
15821404 ctttgacttatgttggtttttgggcttttgttttgtgctctttcagtggatcagaggtcgagaggttgtggaaacaacttgttcatttggttaggagctt 15821305  T
350 ttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttcgtttg 412  Q
    ||||   |||||||  || || ||||||||| ||||||||||||||||||| |||||| ||||    
15821304 ttcgaatgtggctcagctcggatgttgaagtctgggagttttattttgaggagtgttcttttg 15821242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 158 - 330
Target Start/End: Original strand, 36630800 - 36630973
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||| ||||||||||||||||||||||||| || | |||||||||||||||||||||| |||||||||||| ||||||||||||| ||||| |||||| |    
36630800 ttctttggtgtaccgggggcgaggggtgccctgctaatttggttctaaagtctggtgggccgatcacttttaattcgagatcgggtgtcagttctttgac 36630899  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatg 330  Q
    || |||| ||||||||| |||||||||||||||||||| |||||| ||||||| |||||||||| | |||||||    
36630900 tctagtttgtttttgggcttttgttttgtgctctttcgatggatcggaggtcgcgaggttgtgggagctgcatg 36630973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 225 - 407
Target Start/End: Complemental strand, 38577840 - 38577657
Alignment:
225 tttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaac 324  Q
    |||||||||||||||||||| || ||||||| | ||||||||||||||  ||||||||||||||||||||||||||||||||||||||| |||||||| |    
38577840 tttgattcgagatcgggagttagttctttggtttaagttggtttttggacttttgttttgtgctctttcggtggatcagaggtcgagagtttgtggaagc 38577741  T
325 tgcatgttcatttggttagtagcttttcgctcgtggctcgacttgggtgttgaagt-ttgggagttttattttgaggggtgttc 407  Q
    |||||||||||| |||| | |||||||||    |||| | |||||||||||||||| | ||||||||||||||| || ||||||    
38577740 tgcatgttcattcggtttggagcttttcgaatatggcgcaacttgggtgttgaagtctggggagttttattttgtggagtgttc 38577657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 158 - 316
Target Start/End: Complemental strand, 24995513 - 24995355
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcct-gatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||| |||||||||||||| || | | ||||||| ||| |||||||||| |||||||||||||||||||||||||||||||| |||||| |    
24995513 ttctctggtgtactgggggcgaggggtgtcttgctaatttggtactatagtctggtgggccgatcacttttgattcgagatcgggagtcagttctttgac 24995414  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |||||||||||||||||  ||||| |||||||||||| |||| |||||||||| ||||||    
24995413 tcaagttggtttttggg-ctttgtgttgtgctctttcagtgggtcagaggtcgcgaggtt 24995355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 158 - 316
Target Start/End: Complemental strand, 32066413 - 32066255
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||| ||||||||||||||||||||||| || | ||||||| ||| |||||||||| ||||||||||||||||||| ||||||||||||||||||| |    
32066413 ttctctagtgtaccgggggcgaggggtgccctgctaatttggtgctatagtctggtgggccgatcacttttgattcgaaatcgggagtcagctctttgac 32066314  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    || ||||||||||||||  ||||| ||||||||||||||||| |||||||| | ||||||    
32066313 tccagttggtttttggg-ctttgtgttgtgctctttcggtggttcagaggttgcgaggtt 32066255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 158 - 316
Target Start/End: Complemental strand, 31207479 - 31207322
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggct 257  Q
    |||||||||||||| ||||||||||   |||| | ||||||| ||| |||||||||| |||||||||||||||||||||||||||||||| |||||| ||    
31207479 ttctctggtgtaccaggggcgagggtgccctgctaatttggtactatagtctggtgggccgatcacttttgattcgagatcgggagtcagttctttgact 31207380  T
258 caagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |||||||| |||||||| ||||| ||||||| |||||||||||| ||||||| ||||||    
31207379 caagttggattttggga-tttgtgttgtgctttttcggtggatcggaggtcgcgaggtt 31207322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 158 - 316
Target Start/End: Complemental strand, 34389123 - 34388965
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||||| ||||||||||||||| || | ||||||| ||| |||||||||| |||||||||||||||||||||||  ||||||| |||||| |    
34389123 ttctctggtgtaccaggggcgaggggtgccctgctaatttggtactatagtctggtgggccgatcacttttgattcgagatcaagagtcagttctttgac 34389024  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |||||||||||||||||  ||||| ||||||| ||||||||||||  |||||| ||||||    
34389023 tcaagttggtttttggg-ctttgtgttgtgctatttcggtggatcgtaggtcgtgaggtt 34388965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 158 - 316
Target Start/End: Complemental strand, 37986976 - 37986818
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||||||||||||||||||||| || | |||||||  || |||||||||| || |||| |||||||||||||||||||||||| |||||| |    
37986976 ttctctggtgtaccgggggcgaggggtgccctgctaatttggtgttatagtctggtgggccaatcatttttgattcgagatcgggagtcagttctttgac 37986877  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    ||||||||||||||| |  ||||| ||||||||||||||||| || ||||||| ||||||    
37986876 tcaagttggtttttgtg-ctttgtgttgtgctctttcggtggttcggaggtcgcgaggtt 37986818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 158 - 307
Target Start/End: Original strand, 9519462 - 9519611
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||||||||| |||||||||| || | ||||||| ||| ||||| |||| ||||||| |||||||||||||||||||||||| |||||| |    
9519462 ttctctggtgtaccgggggtgaggggtgccctgctaatttggtactatagtctagtgggccgatcagttttgattcgagatcgggagtcagttctttgac 9519561  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggt 307  Q
    |||||||||||||||||  ||||| ||||||||||||||||| || |||||    
9519562 tcaagttggtttttggg-ctttgtgttgtgctctttcggtgggtcggaggt 9519611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 174 - 316
Target Start/End: Complemental strand, 16457562 - 16457421
Alignment:
174 gggcgaggggtg-cctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgg 272  Q
    |||||||||||| |||| | ||||| | ||| ||| |||||| |||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |    
16457562 gggcgaggggtgtcctgctaatttgatactatagtttggtgg-ccgatcacttttgattcgagatcgggagtcagttctttgactcaagttggtttttag 16457464  T
273 gattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |  ||||| ||||||||||||||||| || || |||| ||||||    
16457463 g-ctttgtgttgtgctctttcggtggttcggatgtcgtgaggtt 16457421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 158 - 263
Target Start/End: Complemental strand, 10248671 - 10248565
Alignment:
158 ttctctggtgtaccgggggcgaggggtg-cctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||||||||| |||||||| |||  | |||| || ||||| | |||||||||||||||||||||||| |||||||||||||| ||||||||    
10248671 ttctctggtgtaccgggggtgaggggtgtccttctaattttgtcctaaaatttggtggaccgatcacttttgattcaagatcgggagtcagttctttggc 10248572  T
257 tcaagtt 263  Q
    |||||||    
10248571 tcaagtt 10248565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 201 - 406
Target Start/End: Complemental strand, 17657076 - 17656873
Alignment:
201 ctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggat 300  Q
    ||||||| ||||||  ||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||  |||  || ||   |||||||||||||    
17657076 ctaaagtatggtgggtcgatcacttttgattcgagatcgggagtcagttctttggctcaagtttggttttggacttt--ttatggtttctttcggtggat 17656979  T
301 cagaggtcgagaggttgtggaaactgcatgttcatttggttagtagcttttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgagg 400  Q
    | |||||||| |||| |||||| ||| ||| || ||    ||| ||||||||    ||||||| |||| |||||| | | |||||||||| |||||||||    
17656978 cggaggtcgataggtggtggaagctgaatgatctttcatataggagcttttcagaggtggctcaactttggtgttcatgattgggagtttaattttgagg 17656879  T
401 ggtgtt 406  Q
    ||||||    
17656878 ggtgtt 17656873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 216 - 316
Target Start/End: Original strand, 20138448 - 20138547
Alignment:
216 ccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggt 315  Q
    |||||||||||||||| ||||||||||||||| |||||| || | |||||||||||||  ||||| |||||||||||||||||||| ||||||| |||||    
20138448 ccgatcacttttgatttgagatcgggagtcagttctttgacttatgttggtttttggg-ctttgtgttgtgctctttcggtggatcggaggtcgcgaggt 20138546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 158 - 278
Target Start/End: Complemental strand, 30236246 - 30236125
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||| ||||||||  ||||||||| |  |||||||||| | |||||||||||  ||||| ||||||||||||||||||||||||| |||||||     
30236246 ttctctggtggaccgggggtaaggggtgcccttctgatttggttttgaagtctggtgggacgatcgcttttgattcgagatcgggagtcagttctttggt 30236147  T
257 tcaagttggtttttgggatttt 278  Q
    ||||||| | ||||||| ||||    
30236146 tcaagtttggttttgggctttt 30236125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 200 - 309
Target Start/End: Complemental strand, 41893475 - 41893368
Alignment:
200 tctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtgga 299  Q
    |||| |||||||||| || | ||||||||||||||||||||||||||| |||||| |||||||| |||||||||  ||||| ||||||||||| |||||     
41893475 tctatagtctggtgggccaaccacttttgattcgagatcgggagtcagttctttgtctcaagtt-gtttttggg-ctttgtgttgtgctcttttggtggt 41893378  T
300 tcagaggtcg 309  Q
    | ||||||||    
41893377 taagaggtcg 41893368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 194 - 273
Target Start/End: Original strand, 15906686 - 15906765
Alignment:
194 tttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttggg 273  Q
    |||||| || ||||||||||| |||||||| ||||||||||||||||||||||| ||||||| ||||||| | |||||||    
15906686 tttggtcctgaagtctggtgggccgatcacatttgattcgagatcgggagtcagttctttggttcaagtttggttttggg 15906765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 158 - 247
Target Start/End: Original strand, 10552232 - 10552321
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    |||||||||  ||| ||||| |||||||||   |||||||||||| ||||||||||| |||||| |||||||||| ||||||||||||||    
10552232 ttctctggtagaccaggggcaaggggtgccctctgatttggttctgaagtctggtgggccgatcgcttttgattctagatcgggagtcag 10552321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 172 - 316
Target Start/End: Complemental strand, 12898378 - 12898234
Alignment:
172 gggggcgaggggtgcctgatga-tttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggttttt 270  Q
    ||||||||||||||||  || | ||||||  || |||||||||  ||||||||||||||||||||||| |||||||| | | |  |||||||||| ||||    
12898378 gggggcgaggggtgccctattaatttggtaatatagtctggtgacccgatcacttttgattcgagatccggagtcagttatctaactcaagttgg-tttt 12898280  T
271 gggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |||  ||||| ||||||||||||| ||| || ||||||| ||||||    
12898279 ggggctttgtgttgtgctctttcgatggttcggaggtcgcgaggtt 12898234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 204 - 315
Target Start/End: Complemental strand, 12198140 - 12198030
Alignment:
204 aagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcag 303  Q
    |||||||||||||||||||||||| |||  | || ||||||||| ||||||||||||||| | ||||| | |||| |||  || ||||||  |||||| |    
12198140 aagtctggtggaccgatcacttttaattgaaaattgggagtcagttctttggctcaagtttggttttgagctttt-tttgatgttctttcaatggatcgg 12198042  T
304 aggtcgagaggt 315  Q
    ||||||||||||    
12198041 aggtcgagaggt 12198030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 204 - 315
Target Start/End: Complemental strand, 12442568 - 12442458
Alignment:
204 aagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcag 303  Q
    |||||||||||||||||||||||| |||  | || ||||||||| ||||||||||||||| | ||||| | |||| |||  || ||||||  |||||| |    
12442568 aagtctggtggaccgatcacttttaattgaaaattgggagtcagttctttggctcaagtttggttttgagctttt-tttgatgttctttcaatggatcgg 12442470  T
304 aggtcgagaggt 315  Q
    ||||||||||||    
12442469 aggtcgagaggt 12442458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 280 - 342
Target Start/End: Complemental strand, 35816238 - 35816176
Alignment:
280 ttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggtta 342  Q
    ||||||||||||| |||||||| ||||| ||||| |||||||| ||||||||||||| |||||    
35816238 ttttgtgctcttttggtggatcggaggttgagagattgtggaagctgcatgttcattcggtta 35816176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 191 - 307
Target Start/End: Original strand, 35062454 - 35062568
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctct 290  Q
    |||||||||||| ||||||||||| ||||||  |||||||||||||||| ||||||| ||| | | || |||| | ||||||| |||  ||  ||| ||     
35062454 tgatttggttctgaagtctggtgggccgatcgattttgattcgagatcgagagtcagttctcttgttctagtttggttttgggcttt--ttaggtgttcc 35062551  T
291 ttcggtggatcagaggt 307  Q
    |||||||||||||||||    
35062552 ttcggtggatcagaggt 35062568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 160 - 322
Target Start/End: Complemental strand, 17720821 - 17720661
Alignment:
160 ctctggtgtaccgggggcgaggggtgcctga-tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctc 258  Q
    |||||||| ||| ||||  |||||||||||  || |||||| ||||||| |||||| | |||| ||||||||||| ||||||||||||| ||||||| ||    
17720821 ctctggtggaccaggggtaaggggtgcctgtctggtttggtcctaaagtatggtgggctgatcgcttttgattcg-gatcgggagtcagttctttggttc 17720723  T
259 aagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaa 322  Q
    || || | ||||||| | |  ||| ||| ||||||||||||   ||||| ||||||| ||||||    
17720722 aatttaggttttgggctgt--tttggtgttctttcggtggacttgaggttgagaggtggtggaa 17720661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 191 - 278
Target Start/End: Complemental strand, 32945787 - 32945700
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggatttt 278  Q
    ||||||| |||| |||| | |||| | |||||||||||||||||||||||||||||  ||||||  ||||||| | ||||||| ||||    
32945787 tgatttgattctgaagtatagtgggctgatcacttttgattcgagatcgggagtcaattctttgattcaagtttggttttgggctttt 32945700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 204 - 247
Target Start/End: Original strand, 23264716 - 23264759
Alignment:
204 aagtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    ||||||| |||||| |||| ||||||||||||||||||||||||    
23264716 aagtctgatggacctatcaattttgattcgagatcgggagtcag 23264759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 204 - 243
Target Start/End: Original strand, 40531242 - 40531281
Alignment:
204 aagtctggtggaccgatcacttttgattcgagatcgggag 243  Q
    ||||||| ||| ||||||||||||||||||||||||||||    
40531242 aagtctgatgggccgatcacttttgattcgagatcgggag 40531281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 205 - 243
Target Start/End: Original strand, 33967337 - 33967375
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggag 243  Q
    |||||||||| ||||||||||||||||||||||| ||||    
33967337 agtctggtgggccgatcacttttgattcgagatcaggag 33967375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 357 - 401
Target Start/End: Complemental strand, 31207279 - 31207235
Alignment:
357 gtggctcgacttgggtgttgaagtttgggagttttattttgaggg 401  Q
    |||||||  ||||||||||| ||| ||||||||||||||||||||    
31207279 gtggctcagcttgggtgttggagtatgggagttttattttgaggg 31207235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 154; Significance: 2e-81; HSPs: 33)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 151 - 407
Target Start/End: Original strand, 2825739 - 2825996
Alignment:
151 tatggtgttctctggtgtaccgggggcgaggggtgc-ctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagct 249  Q
    |||||||||||||||||||||| ||||||||||||| ||| |||||||||||||||||| ||||| ||||||| ||||||||||||||||||| ||| ||    
2825739 tatggtgttctctggtgtaccgagggcgaggggtgctctgctgatttggttctaaagtccggtgggccgatcatttttgattcgagatcgggaatcacct 2825838  T
250 ctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagctt 349  Q
    |||||||||||  ||||||||||| |||| |||||| ||||||||||||||| |||||| ||||||||||||| ||||||||||||| |||||| |||||    
2825839 ctttggctcaatgtggtttttgggcttttattttgtactctttcggtggatcggaggtctagaggttgtggaagctgcatgttcattcggttaggagctt 2825938  T
350 ttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttc 407  Q
    ||||   |||| ||   |||||||||||||||||||||||||||||||||||||||||    
2825939 ttcgaaggtggttcagtttgggtgttgaagtttgggagttttattttgaggggtgttc 2825996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 151 - 407
Target Start/End: Complemental strand, 31050787 - 31050529
Alignment:
151 tatggtgttctctggtgtaccgggggcgaggggtgcctga-tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagct 249  Q
    ||||||||||| || ||||||||||||||||||||||  | |||||||||||||||||||||||| ||||||||||||||||||||||||| ||| || |    
31050787 tatggtgttctttgatgtaccgggggcgaggggtgccctactgatttggttctaaagtctggtgggccgatcacttttgattcgagatcggaagttaggt 31050688  T
250 ctttggctcaagttggtttttgggattttgtttt-gtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagct 348  Q
    |||||| |  |||||||||||||| ||||||||| |||||||||| ||||||| |||||||||||||||||||| ||||||||||||| |||||| ||||    
31050687 ctttggtttgagttggtttttgggcttttgtttttgtgctctttcagtggatcggaggtcgagaggttgtggaagctgcatgttcattcggttaggagct 31050588  T
349 tttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttc 407  Q
    ||||| | ||||||   ||||||||||||||| |||  |||||||||||||||||||||    
31050587 tttcgattgtggctaagcttgggtgttgaagtctggctgttttattttgaggggtgttc 31050529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 222 - 407
Target Start/End: Complemental strand, 35341391 - 35341207
Alignment:
222 acttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtgga 321  Q
    ||||||||| ||||||||| |||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||| ||| |||||||||||||||    
35341391 acttttgatccgagatcggaagtcagctctttggctcaagttggtttttggccttttgttttgtgctctttcggtggatcggagttcgagaggttgtgga 35341292  T
322 aactgcatgttcatttggttagtagcttttcgctcgtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgttc 407  Q
    | |||||||||||||  ||||  |||||||||   ||||||| | || ||||||||||||||||||||||||||||||||||||||    
35341291 agctgcatgttcattcagttatgagcttttcgaatgtggctc-agtttggtgttgaagtttgggagttttattttgaggggtgttc 35341207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 158 - 316
Target Start/End: Original strand, 8254990 - 8255148
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||||||||||||||||||||| || | ||||||| |||||||||||||| ||||||||||||||| ||||||| | |||||| |||||| |    
8254990 ttctctggtgtaccgggggcgaggggtgccctgctaatttggtactaaagtctggtgggccgatcacttttgatccgagatcagaagtcagttctttgac 8255089  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |||||||||||||||||  |||||||||||||||||||||||||| ||||||| ||||||    
8255090 tcaagttggtttttggg-ctttgttttgtgctctttcggtggatcggaggtcgcgaggtt 8255148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 158 - 316
Target Start/End: Original strand, 8268408 - 8268566
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||||||||||||||||||||| || | ||||||| |||||||||||||| ||||||||||||||| ||||||| | |||||| |||||| |    
8268408 ttctctggtgtaccgggggcgaggggtgccctgctaatttggtactaaagtctggtgggccgatcacttttgatccgagatcagaagtcagttctttgac 8268507  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |||||||||||||||||  |||||||||||||||||||||||||| ||||||| ||||||    
8268508 tcaagttggtttttggg-ctttgttttgtgctctttcggtggatcggaggtcgcgaggtt 8268566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 158 - 316
Target Start/End: Original strand, 30964404 - 30964562
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||||| |||||||||||||| || | ||||||| ||| | |||| ||| |||||||||||||||||| ||||||||||| | |||||| |    
30964404 ttctctggtgtaccgagggcgaggggtgccctgctaatttggtactataatctgatgggccgatcacttttgattcgtgatcgggagtccgttctttgac 30964503  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    ||||||||||||||||| |||||| ||||||||||| ||||| || ||||||| ||||||    
30964504 tcaagttggtttttggg-ttttgtgttgtgctcttttggtggttcggaggtcgcgaggtt 30964562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 158 - 401
Target Start/End: Original strand, 4305688 - 4305932
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||||||||||| || |||||| || | ||||||| ||| ||||||||||  |||||||||||||||||||||||||||| || |||||| |    
4305688 ttctctggtgtaccgggggcaagcggtgccctgctaatttggtactatagtctggtggggcgatcacttttgattcgagatcgggagttagttctttgtc 4305787  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagagg-ttgtggaaactgcatgttcatttggttagtagcttttcgct 355  Q
    |||||||||||||| ||  ||||| ||||||||||| |||||  |||||||||  ||| |||||  ||||||||| || || ||| ||  ||| ||||      
4305788 tcaagttggtttttagg-ctttgtgttgtgctcttttggtggtccagaggtcgcaaggtttgtgataactgcatgatccttcggtgaggtgctcttcgaa 4305886  T
356 cgtggctcgacttgggtgttgaagtttgggagttttattttgaggg 401  Q
     ||||||| |||||||| ||   |||||||||||||||||| ||||    
4305887 tgtggctcaacttgggtatttgggtttgggagttttattttcaggg 4305932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 158 - 322
Target Start/End: Complemental strand, 53823539 - 53823376
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||||||| || |||||||||| |  |||||||||  |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||    
53823539 ttctctggtgtaccggaggtgaggggtgcccttctgatttggtcataaagtctggtggaccaatcacttttgattcgagatcgggagtcagttctttggc 53823440  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaa 322  Q
    ||||||| | |||||||  ||| || ||   ||||||||| ||||  |||||||||||| ||||||    
53823439 tcaagtttggttttggg--ttttttatggtttctttcggttgatcgaaggtcgagaggtggtggaa 53823376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 158 - 310
Target Start/End: Original strand, 25753135 - 25753286
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcctga-tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||||||| || |||| ||||| |  | ||||||| ||||||||||||||  ||||||||||||||||||||||||||||||| ||||||||    
25753135 ttctctggtgtaccggaggtgaggagtgcccgtcttatttggtcctaaagtctggtggggcgatcacttttgattcgagatcgggagtcagttctttggc 25753234  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcga 310  Q
    ||||||| | ||||||| |||| | ||||  |||||||||||||| ||||||||    
25753235 tcaagtttgattttgggctttt-tattgt-ttctttcggtggatcggaggtcga 25753286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 169 - 263
Target Start/End: Complemental strand, 19815331 - 19815236
Alignment:
169 accgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagtt 263  Q
    |||||||| |||||||||| |  || |||||| |||||||||||||||||||| |||||| |||||||||| |||||||| |||||||||||||||    
19815331 accgggggtgaggggtgcccttctgttttggtcctaaagtctggtggaccgattactttttattcgagatcaggagtcagttctttggctcaagtt 19815236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 217 - 316
Target Start/End: Complemental strand, 30167622 - 30167524
Alignment:
217 cgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    ||||||||||||||||||||||||||||| | |||||| ||||||||| ||||||||  ||||| |||||||||||||||||  | ||||||| ||||||    
30167622 cgatcacttttgattcgagatcgggagtcggttctttgactcaagttgatttttggg-gtttgtgttgtgctctttcggtggtccggaggtcgcgaggtt 30167524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 191 - 263
Target Start/End: Complemental strand, 22811244 - 22811172
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagtt 263  Q
    |||||||||  ||||||||||||| ||||||| |||| ||||||||||||||||||| |||||||||||||||    
22811244 tgatttggtcttaaagtctggtgggccgatcattttttattcgagatcgggagtcagttctttggctcaagtt 22811172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 158 - 322
Target Start/End: Complemental strand, 2061856 - 2061693
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||| ||  || |||||||||| |  ||||||| | |||||||||||||| | |||||||||||||||||||| | ||||||| |||||||     
2061856 ttctctggtgtatcgaaggtgaggggtgccctcttgatttgatcctaaagtctggtgggctgatcacttttgattcgagattgagagtcagttctttgga 2061757  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaa 322  Q
    |||  || | ||||||| |||||   ||   |||||||||||||| ||||||||||||| ||||||    
2061756 tcagttttgattttgggcttttg--atgatttctttcggtggatcggaggtcgagaggtggtggaa 2061693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 191 - 299
Target Start/End: Original strand, 35800486 - 35800592
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctct 290  Q
    |||||||||||| |||||||||| ||||||| |||||||||||||||||| |||||| ||||||  || |||| | ||||||| |||  ||| ||| |||    
35800486 tgatttggttctgaagtctggtgaaccgatcgcttttgattcgagatcggaagtcagttctttgattccagtttggttttgggcttt--tttggtgttct 35800583  T
291 ttcggtgga 299  Q
    |||||||||    
35800584 ttcggtgga 35800592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 158 - 278
Target Start/End: Original strand, 38929790 - 38929911
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcctga-tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||| ||||||||  ||||||||| |  || || ||| || ||||||| ||| |||||||||||||||||||||||  ||||||| ||||||||    
38929790 ttctctggtggaccgggggtaaggggtgcccgtctggttgggtcctgaagtctgctgggccgatcacttttgattcgagatcaagagtcagttctttggc 38929889  T
257 tcaagttggtttttgggatttt 278  Q
    ||||||| | ||||||| ||||    
38929890 tcaagtttgattttgggctttt 38929911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 191 - 263
Target Start/End: Original strand, 49747524 - 49747596
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagtt 263  Q
    |||||||||||||||||||||||  |||||||||||||||| ||||||| ||||||| ||||| | |||||||    
49747524 tgatttggttctaaagtctggtgagccgatcacttttgatttgagatcgagagtcagttcttttgatcaagtt 49747596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 204 - 278
Target Start/End: Original strand, 16501741 - 16501815
Alignment:
204 aagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggatttt 278  Q
    |||| |||||| |||||| ||||||||||||||||||||||||||||||||| || |||| | ||||||| ||||    
16501741 aagtttggtgggccgatcgcttttgattcgagatcgggagtcagctctttggttctagtttggttttgggctttt 16501815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 205 - 322
Target Start/End: Complemental strand, 38637302 - 38637188
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcaga 304  Q
    ||||||| || |||||||||||||||||||||||||||||||  ||||||||| |||| || ||||||| |||  || ||   ||||| |||||||| ||    
38637302 agtctggcgggccgatcacttttgattcgagatcgggagtcaattctttggcttaagtagg-ttttgggcttt--ttatggtttcttttggtggatcgga 38637206  T
305 ggtcgagaggttgtggaa 322  Q
    ||||||||||| ||||||    
38637205 ggtcgagaggtggtggaa 38637188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 191 - 252
Target Start/End: Complemental strand, 21387288 - 21387227
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctt 252  Q
    ||||||||| ||  |||||||||||||||||||||||||||||||||||| |||||| ||||    
21387288 tgatttggtgctggagtctggtggaccgatcacttttgattcgagatcggaagtcagttctt 21387227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 218 - 322
Target Start/End: Complemental strand, 41118024 - 41117922
Alignment:
218 gatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttg 317  Q
    ||||||||||||||||||||||| ||| || |||||||||||| || | ||||||| |||  || ||   ||||||| |||||||||||||||||||| |    
41118024 gatcacttttgattcgagatcggaagtaagttctttggctcaaattaggttttgggcttt--ttatggtttctttcgatggatcagaggtcgagaggtgg 41117927  T
318 tggaa 322  Q
    |||||    
41117926 tggaa 41117922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 158 - 301
Target Start/End: Original strand, 19673064 - 19673205
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||  | |||||| |||||||||| |  || |||||| |||||||||||||||||  || ||||| |||||||||| |||||||| ||||||||    
19673064 ttctctggttgatcgggggtgaggggtgcccttctgttttggtcctaaagtctggtggaccattccctttt-attcgagatcaggagtcagttctttggc 19673162  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatc 301  Q
    |||||||   ||||||| ||||| || ||| ||||||||||||||    
19673163 tcaagtttagttttggg-ttttg-ttggtgttctttcggtggatc 19673205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 191 - 263
Target Start/End: Complemental strand, 46698869 - 46698797
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagtt 263  Q
    ||||||||| ||  |||||||||| |||||  ||||||||||||||||||||||||| ||||||| |||||||    
46698869 tgatttggtcctgtagtctggtgggccgattgcttttgattcgagatcgggagtcagttctttggttcaagtt 46698797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 191 - 265
Target Start/End: Complemental strand, 36962699 - 36962626
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttgg 265  Q
    |||||||||| |  |||||||||| ||||| ||||||||||||||||| |||||||| |||||| ||||||||||    
36962699 tgatttggttttggagtctggtgggccgattacttttgattcgagatcaggagtcag-tctttgactcaagttgg 36962626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 191 - 263
Target Start/End: Complemental strand, 6600029 - 6599957
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagtt 263  Q
    |||||||| |||| |||||||||| |||||| ||||||||| ||||||||||||| | ||||||  |||||||    
6600029 tgatttggctctagagtctggtgggccgatcgcttttgattagagatcgggagtcggttctttgattcaagtt 6599957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 28966897 - 28966951
Alignment:
224 ttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggatttt 278  Q
    |||||||||||||| ||||||||| ||||||||||||||| | ||||||| ||||    
28966897 ttttgattcgagattgggagtcagttctttggctcaagtttggttttgggctttt 28966951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 205 - 247
Target Start/End: Complemental strand, 39041344 - 39041302
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    |||||||||| ||||||||||||||||||||||| ||||||||    
39041344 agtctggtgggccgatcacttttgattcgagatcaggagtcag 39041302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 208 - 246
Target Start/End: Complemental strand, 39421080 - 39421042
Alignment:
208 ctggtggaccgatcacttttgattcgagatcgggagtca 246  Q
    ||||||| |||||||||||||||||||||||||||||||    
39421080 ctggtgggccgatcacttttgattcgagatcgggagtca 39421042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 205 - 243
Target Start/End: Complemental strand, 40813851 - 40813813
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggag 243  Q
    |||||||||| ||||||||||||||||||||||||||||    
40813851 agtctggtgggccgatcacttttgattcgagatcgggag 40813813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 204 - 240
Target Start/End: Original strand, 53756766 - 53756802
Alignment:
204 aagtctggtggaccgatcacttttgattcgagatcgg 240  Q
    ||||||||||| |||||||||||||||||||||||||    
53756766 aagtctggtgggccgatcacttttgattcgagatcgg 53756802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 194 - 299
Target Start/End: Original strand, 12296175 - 12296278
Alignment:
194 tttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttc 293  Q
    |||||| || ||||||||||  |||| | ||||||||||||||||   |||||| ||||||| ||||||| | ||||||| |||  ||| ||| ||||||    
12296175 tttggtcctgaagtctggtgtgccgagcgcttttgattcgagatcaaaagtcagttctttggttcaagtttgattttgggcttt--tttggtgttctttc 12296272  T
294 ggtgga 299  Q
    ||||||    
12296273 ggtgga 12296278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 166 - 247
Target Start/End: Complemental strand, 19311451 - 19311371
Alignment:
166 tgtaccgggggcgaggggtg-cctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    |||| |||||| |||||||| |||  |||||||||| ||| |||||||||  |||||||||||||||||||| ||||||||||    
19311451 tgtaacgggggtgaggggtgtccttctgatttggttttaa-gtctggtgggtcgatcacttttgattcgaga-cgggagtcag 19311371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 205 - 238
Target Start/End: Complemental strand, 37707425 - 37707392
Alignment:
205 agtctggtggaccgatcacttttgattcgagatc 238  Q
    |||||||||| |||||||||||||||||||||||    
37707425 agtctggtgggccgatcacttttgattcgagatc 37707392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 191 - 247
Target Start/End: Original strand, 2165505 - 2165560
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    ||||||| ||||| ||| |||||| |||||| ||||||||| |||||||||||||||    
2165505 tgatttgtttctagagtttggtgg-ccgatcgcttttgatttgagatcgggagtcag 2165560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 97; Significance: 2e-47; HSPs: 25)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 158 - 401
Target Start/End: Original strand, 29087444 - 29087688
Alignment:
158 ttctctggtgtaccgggggcgaggggtgc-ctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||| ||||||||||||||||||||| ||| |  ||||||||||||||||||||||| |||| |||||||||||||||| |||||||| ||||||      
29087444 ttctctgttgtaccgggggcgaggggtgctctgctattttggttctaaagtctggtggactgatcccttttgattcgagatcaggagtcagttctttgaa 29087543  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagcttttcgctc 356  Q
    |||| ||||||| |||| ||||||||||||||||||||||||||| ||||||| |||||| ||| | || |||| || |||||| ||  ||| ||||       
29087544 tcaaattggtttctgggcttttgttttgtgctctttcggtggatcggaggtcgcgaggttatggtagctccatgatcctttggtcaggtgctcttcgtat 29087643  T
357 gtggctcgacttgggtgttgaagtttgggagttttattttgaggg 401  Q
    ||||||| |||| | |||||  || |||||| |||||||||||||    
29087644 gtggctcaacttagatgttggggtctgggagctttattttgaggg 29087688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 158 - 316
Target Start/End: Original strand, 34378061 - 34378219
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||||||||||| ||| ||||| || | ||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||||| |    
34378061 ttctctggtgtaccgggggcaaggagtgccctgctaatttggtactaaagtctggtgggccgatcacttttgattcgagatcgggagtcagttctttgac 34378160  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
     ||||||||||||||||  |||||||||||||||||||||||| | ||||||| ||||||    
34378161 acaagttggtttttggg-ctttgttttgtgctctttcggtggaccggaggtcgcgaggtt 34378219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 158 - 316
Target Start/End: Original strand, 698324 - 698482
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||||||||||||||||||||| || | ||||||| ||| ||||||||||||||||| |||||||||||||||||||||||| ||||||| |    
698324 ttctctggtgtaccgggggcgaggggtgccctgctaatttggtgctatagtctggtggaccgatctcttttgattcgagatcgggagtcaactctttgac 698423  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |||||||||||||||||  ||||| |||| ||||||| |||| |||||||| | ||||||    
698424 tcaagttggtttttggg-ctttgtgttgtactctttctgtggttcagaggttgcgaggtt 698482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 158 - 326
Target Start/End: Complemental strand, 13954351 - 13954185
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggct 257  Q
    |||||||||||||||  || |||||||||||  ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||   ||||||||    
13954351 ttctctggtgtaccgaaggtgaggggtgccttctgatttggtcctaaagtctggtgggccgatcacttttgattcgagatcgggagtcattactttggct 13954252  T
258 caagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactg 326  Q
    |||||| | ||||||| |||  || ||   |||||||||||||| || || || |||| ||||||||||    
13954251 caagtttggttttgggcttt--ttatggtttctttcggtggatcggaagttgaaaggtggtggaaactg 13954185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 158 - 309
Target Start/End: Original strand, 18593206 - 18593357
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||| |||||||||||||||||| |||| || | ||||||| ||| ||| | |||| | ||||||||||||||||||||||||||| || |||||| |    
18593206 ttctctcgtgtaccgggggcgagggatgccctgctaatttggtgctatagtttagtgggcagatcacttttgattcgagatcgggagttagttctttgac 18593305  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcg 309  Q
    |||||||||||||||||  || || ||||||||||||||||| || |||||||    
18593306 tcaagttggtttttggg-cttagtgttgtgctctttcggtggttcggaggtcg 18593357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 158 - 256
Target Start/End: Complemental strand, 7392149 - 7392050
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||| ||||||| ||| |||||||||| |  ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
7392149 ttctctgatgtaccgagggtgaggggtgcccttctgatttggtcctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagttctttggc 7392050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 158 - 330
Target Start/End: Complemental strand, 14302548 - 14302377
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||| || ||| ||||| |||| |  || |||||| |||||||||||||||| ||||||||||| |||||||| ||||||||| |||||||     
14302548 ttctctggtgtatcgagggtgagggatgcccttctgttttggtcctaaagtctggtggactgatcacttttggttcgagattgggagtcagttctttgga 14302449  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatg 330  Q
     |||||| | ||||||| |||  || ||   |||||||||||||| ||||||||||||| |||||| |||||||    
14302448 gcaagtttggttttgggcttt--ttatggtttctttcggtggatcggaggtcgagaggtggtggaagctgcatg 14302377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 197 - 273
Target Start/End: Complemental strand, 22675402 - 22675326
Alignment:
197 ggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttggg 273  Q
    |||||||||||||||||||||||||  |||||||||||||||||||||||| ||||||||||||||| | |||||||    
22675402 ggttctaaagtctggtggaccgatcgattttgattcgagatcgggagtcagttctttggctcaagtttggttttggg 22675326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 239 - 322
Target Start/End: Complemental strand, 7162353 - 7162270
Alignment:
239 gggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaa 322  Q
    ||||||||| |||||| |||||||||||||||||| |||||||||||||||||||| |||||| ||||||| |||||| |||||    
7162353 gggagtcagttctttgactcaagttggtttttgggtttttgttttgtgctctttcgatggatcggaggtcgcgaggttatggaa 7162270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 158 - 406
Target Start/End: Original strand, 8297431 - 8297678
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||| |||||||| ||| |||||||||| |  ||||||||||||||||  |||||| |  || | |||||||||||||||||||||||| ||||||||    
8297431 ttctctagtgtaccgagggtgaggggtgcccttctgatttggttctaaagcatggtgggctaataatttttgattcgagatcgggagtcagttctttggc 8297530  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagcttttcgctc 356  Q
    ||||||| | ||||||  |||  || ||   |||||||||| ||| ||||||| ||||| ||||||  || ||| || || || ||| |||||||||       
8297531 tcaagtttggttttggacttt--ttatggtttctttcggtgaatcggaggtcgtgaggtggtggaagttgaatggtctttcggataggagcttttcggat 8297628  T
357 gtggctcgacttgggtgttgaagtttgggagttttattttgaggggtgtt 406  Q
    ||||||||  || |||||| | | | |||||||| |||||||||||||||    
8297629 gtggctcggttttggtgttcatgatggggagtttaattttgaggggtgtt 8297678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 158 - 322
Target Start/End: Complemental strand, 7195356 - 7195195
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    |||||||||||||| |||  |||||||||| |  ||||||||   ||||||||||||  |||||||||||||||||||||||||||||||| ||||||||    
7195356 ttctctggtgtaccagggt-gaggggtgcccttctgatttggccataaagtctggtgagccgatcacttttgattcgagatcgggagtcagttctttggc 7195258  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaa 322  Q
    ||||||| |  |||||| ||   || ||   | |||||||||||| ||||||||||||| ||||||    
7195257 tcaagttagagtttgggctt---ttatggtttttttcggtggatcggaggtcgagaggtcgtggaa 7195195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 194 - 272
Target Start/End: Complemental strand, 26046045 - 26045967
Alignment:
194 tttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgg 272  Q
    |||||| ||||||||||||| |||||||||||||||||||||||||||||| ||   ||||||||||||| | ||||||    
26046045 tttggtcctaaagtctggtgaaccgatcacttttgattcgagatcgggagttagtgttttggctcaagtttggttttgg 26045967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 158 - 255
Target Start/End: Complemental strand, 33259000 - 33258902
Alignment:
158 ttctctggtgtaccgggggcgaggggtg-cctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttgg 255  Q
    |||||||||||||||  || |||||||| |||  || |||||| |||||||||||||| ||||||||||||||||||||||| ||||| || |||||||    
33259000 ttctctggtgtaccgaaggtgaggggtgtccttctgttttggtgctaaagtctggtgggccgatcacttttgattcgagatcaggagttagttctttgg 33258902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 206 - 322
Target Start/End: Complemental strand, 39184256 - 39184140
Alignment:
206 gtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaag--ttggtttttgggattttgttttgtgctctttcggtggatcag 303  Q
    ||||||||| ||||||||||||||||||||||||| |||||| ||||||| |||||  || | ||||| | |||  ||| ||| |||||||||||| |||    
39184256 gtctggtgggccgatcacttttgattcgagatcggaagtcagttctttggttcaagcatttggttttgagcttt--tttggtgttctttcggtggaccag 39184159  T
304 aggtcgagaggttgtggaa 322  Q
    |||| | ||||| ||||||    
39184158 aggttgtgaggtagtggaa 39184140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 204 - 298
Target Start/End: Original strand, 27713079 - 27713171
Alignment:
204 aagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtgg 298  Q
    |||||| |||| ||||||  ||||||||||||||||||| |||| ||||||||||||||| | ||||||| |||| | ||||  |||||||||||    
27713079 aagtctagtgggccgatcgtttttgattcgagatcgggaatcagttctttggctcaagtttggttttgggcttttatgttgt--tctttcggtgg 27713171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 194 - 252
Target Start/End: Original strand, 23426344 - 23426402
Alignment:
194 tttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctt 252  Q
    |||||| || |||||||||||||||| ||||||||||||||||| ||||||||| ||||    
23426344 tttggtcctgaagtctggtggaccgaacacttttgattcgagattgggagtcagttctt 23426402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 158 - 247
Target Start/End: Original strand, 31721640 - 31721730
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    |||||||||| ||||||||  ||||||||| |  |||| ||||||| ||||||  ||| |||||| |||||||||||||||||||||||||    
31721640 ttctctggtggaccgggggtaaggggtgcccttctgatgtggttctgaagtctaatgggccgatcgcttttgattcgagatcgggagtcag 31721730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 191 - 264
Target Start/End: Complemental strand, 24072350 - 24072277
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttg 264  Q
    ||||||||| |||||||||||| | | |||| ||||||||| |||||||| |||||| ||||||| ||||||||    
24072350 tgatttggtcctaaagtctggttggctgatcgcttttgatttgagatcggaagtcagttctttggttcaagttg 24072277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 194 - 258
Target Start/End: Original strand, 25992007 - 25992071
Alignment:
194 tttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctc 258  Q
    |||||| |||||||||||||| || ||| ||||||||||||||||| ||||||| ||||| ||||    
25992007 tttggtgctaaagtctggtgggccaatcgcttttgattcgagatcgagagtcagttctttagctc 25992071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 205 - 255
Target Start/End: Original strand, 8730928 - 8730978
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggagtcagctctttgg 255  Q
    ||||||||||||| ||| ||||| ||||||||||||||||||| |||||||    
8730928 agtctggtggacctatcgcttttaattcgagatcgggagtcagttctttgg 8730978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 247
Target Start/End: Original strand, 12046252 - 12046308
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    ||||||| |||  |||| |||||| ||||||||||||||||||||||||||| ||||    
12046252 tgatttgattcggaagtttggtgggccgatcacttttgattcgagatcgggactcag 12046308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 209 - 259
Target Start/End: Complemental strand, 21402903 - 21402853
Alignment:
209 tggtggaccgatcacttttgattcgagatcgggagtcagctctttggctca 259  Q
    |||||| ||||||||||||  |||||||||||||||||| |||||| ||||    
21402903 tggtgggccgatcacttttagttcgagatcgggagtcagttctttgactca 21402853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 178 - 247
Target Start/End: Complemental strand, 28765700 - 28765630
Alignment:
178 gaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    |||||||||| | |||||||  ||||| | |||||||||  |||||||||||||||||||||| |||||||    
28765700 gaggggtgccctaatgatttttttctagattctggtggattgatcacttttgattcgagatcgagagtcag 28765630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 273
Target Start/End: Complemental strand, 39024502 - 39024452
Alignment:
223 cttttgattcgagatcgggagtcagctctttggctcaagttggtttttggg 273  Q
    ||||||||||||||||||||||||  ||||||| ||||||| | |||||||    
39024502 cttttgattcgagatcgggagtcacttctttggttcaagtttggttttggg 39024452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 160 - 263
Target Start/End: Complemental strand, 17854183 - 17854079
Alignment:
160 ctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctc 258  Q
    |||||||| |||||||| |||||||||| |  | |||||||  | |||| |||||| |||| | ||||||| ||||||||||||||||  | ||||| ||    
17854183 ctctggtggaccgggggtgaggggtgcccttctaatttggtcttgaagtatggtgggccgaccgcttttgactcgagatcgggagtcaattatttggttc 17854084  T
259 aagtt 263  Q
    |||||    
17854083 aagtt 17854079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0068 (Bit Score: 76; Significance: 5e-35; HSPs: 1)
Name: scaffold0068
Description:

Target: scaffold0068; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 158 - 308
Target Start/End: Complemental strand, 35889 - 35740
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcct-gatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||||||||||||||||||||| | | |||||||| || ||||| |||| |||||||||||||||||||||||||||||||  |||||| |    
35889 ttctctggtgtaccgggggcgaggggtgcctagctaatttggttatatagtctagtgggccgatcacttttgattcgagatcgggagtca-ttctttgac 35791  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtc 308  Q
    | |||||||||||||||  ||| | |||||||||||||||||||| ||||||    
35790 ttaagttggtttttggg-ctttatgttgtgctctttcggtggatcggaggtc 35740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 68; Significance: 3e-30; HSPs: 19)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 158 - 316
Target Start/End: Original strand, 3117456 - 3117614
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||| |||||||||||||||||| || | ||||| |  || ||| |||||| ||||||||||||||||| |||||||||||||| |||||| |    
3117456 ttctctggtgttccgggggcgaggggtgccctgctaatttgttgatatagtatggtgggccgatcacttttgattcaagatcgggagtcagttctttgac 3117555  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggtt 316  Q
    |||||||||||||||||  ||||| |||||||||||  |||| || ||||||| ||||||    
3117556 tcaagttggtttttggg-ctttgtgttgtgctctttatgtggttcggaggtcgcgaggtt 3117614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 158 - 272
Target Start/End: Complemental strand, 16510419 - 16510304
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||||| |||| ||||||||| || | ||||||||||||||||| |||| |||||||||||||||||||||| | ||||||| |||||  |    
16510419 ttctctggtgtaccgagggcaaggggtgccctgctaatttggttctaaagtctagtgggccgatcacttttgattcgagattgagagtcagttcttttac 16510320  T
257 tcaagttggtttttgg 272  Q
    ||||||||||||||||    
16510319 tcaagttggtttttgg 16510304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 158 - 353
Target Start/End: Complemental strand, 20701921 - 20701727
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||||||||| |||||||||| |  |||||||||  |  || ||||||  ||||||||||||||||||||||||||||| || ||||||||    
20701921 ttctctggtgtaccgggggtgaggggtgcccttctgatttggtcatttagactggtgtgccgatcacttttgattcgagatcgggagttagttctttggc 20701822  T
257 tcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcgagaggttgtggaaactgcatgttcatttggttagtagcttttcg 353  Q
    | ||||| | ||||||| |||  || ||   |||||||||||||| ||||||||||||| |||||| ||| ||| || || || ||| |||||||||    
20701821 ttaagtttggttttgggcttt--ttatggtttctttcggtggatcggaggtcgagaggtagtggaagctgaatgatctttcggataggagcttttcg 20701727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 191 - 330
Target Start/End: Complemental strand, 32935423 - 32935286
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctct 290  Q
    ||||||||| || ||||||||||| |||||| ||||||||||||||||||||||||| |||| | |||||||| | ||||||  |||  ||| ||| |||    
32935423 tgatttggtcctgaagtctggtgggccgatcgcttttgattcgagatcgggagtcagttcttggactcaagtttgattttggacttt--tttagtgttct 32935326  T
291 ttcggtggatcagaggtcgagaggttgtggaaactgcatg 330  Q
    |||||||| ||| |||| | ||||| |||||| |||||||    
32935325 ttcggtggttcaaaggttgggaggtggtggaagctgcatg 32935286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 195 - 297
Target Start/End: Original strand, 9224042 - 9224143
Alignment:
195 ttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcg 294  Q
    ||||| |||||||||||||| | |||| ||||||||||||||||||||||||| ||||||| |||  || | ||||||| ||||  || |||||||||||    
9224042 ttggtcctaaagtctggtgggctgatcgcttttgattcgagatcgggagtcagttctttggttcagttttggttttgggctttt-attggtgctctttcg 9224140  T
295 gtg 297  Q
    |||    
9224141 gtg 9224143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 210 - 263
Target Start/End: Original strand, 13423482 - 13423535
Alignment:
210 ggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagtt 263  Q
    |||||||||||||||||||||||||||||| ||||| | |||||||||||||||    
13423482 ggtggaccgatcacttttgattcgagatcgagagtcggttctttggctcaagtt 13423535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 191 - 252
Target Start/End: Complemental strand, 26216102 - 26216042
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctt 252  Q
    ||||||| |||||| ||||||||| |||||||||||||||||||||||||||||||| ||||    
26216102 tgatttgattctaa-gtctggtgggccgatcacttttgattcgagatcgggagtcagttctt 26216042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 191 - 252
Target Start/End: Complemental strand, 26534803 - 26534742
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctt 252  Q
    ||||||||| || ||||||||||| |||||||||||||||||||||| ||||||||| ||||    
26534803 tgatttggtcctgaagtctggtgggccgatcacttttgattcgagattgggagtcagttctt 26534742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 185 - 273
Target Start/End: Original strand, 21266104 - 21266192
Alignment:
185 gcctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttggg 273  Q
    |||| |||||||||| |||||| ||||||| |||||| |||||||||||||||||||||| || | | ||| ||||||| | |||||||    
21266104 gccttatgatttggtcctaaagactggtgggccgatcgcttttgattcgagatcgggagttagttatgtggttcaagtttggttttggg 21266192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 191 - 247
Target Start/End: Original strand, 34105410 - 34105466
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    ||||||| ||||| ||| |||||| ||||||||||||||||||||||||||||||||    
34105410 tgatttgtttctagagtttggtgggccgatcacttttgattcgagatcgggagtcag 34105466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 151 - 213
Target Start/End: Complemental strand, 15132648 - 15132585
Alignment:
151 tatggtgttctctggtgtaccgggggcgaggggtg-cctgatgatttggttctaaagtctggtg 213  Q
    |||||||||||||| ||||| |||||||||||||| |||| |||||| ||||||||||||||||    
15132648 tatggtgttctctgatgtactgggggcgaggggtgccctgttgattttgttctaaagtctggtg 15132585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 205 - 240
Target Start/End: Complemental strand, 7546499 - 7546464
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgg 240  Q
    ||||||||||||||||||||||||||||||||||||    
7546499 agtctggtggaccgatcacttttgattcgagatcgg 7546464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 194 - 252
Target Start/End: Original strand, 12794114 - 12794173
Alignment:
194 tttggttctaaagtctggtggaccgatca-cttttgattcgagatcgggagtcagctctt 252  Q
    |||||||||||||||| |||| ||||||| |||||||||||||||| |||||||| ||||    
12794114 tttggttctaaagtctagtgggccgatcaacttttgattcgagatcaggagtcagttctt 12794173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 158 - 235
Target Start/End: Complemental strand, 3880701 - 3880623
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgag 235  Q
    ||||||||| ||||| ||| ||| |||||| |  ||||||||| ||||||| |||||| ||||||||||||||||||||    
3880701 ttctctggtttaccgagggtgagaggtgcccttctgatttggtcctaaagtttggtgggccgatcacttttgattcgag 3880623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 218 - 263
Target Start/End: Complemental strand, 33968670 - 33968625
Alignment:
218 gatcacttttgattcgagatcgggagtcagctctttggctcaagtt 263  Q
    |||| ||||||||||||||||||||||||| ||||||| |||||||    
33968670 gatcgcttttgattcgagatcgggagtcagttctttggttcaagtt 33968625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 205 - 247
Target Start/End: Original strand, 34090374 - 34090416
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    ||||||||||  |||||| ||||||||||||||||||||||||    
34090374 agtctggtgggtcgatcaattttgattcgagatcgggagtcag 34090416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 191 - 240
Target Start/End: Original strand, 20499916 - 20499965
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgg 240  Q
    ||||||| ||||  ||| ||||||||||||| ||||||||||||||||||    
20499916 tgatttgattctggagtatggtggaccgatcgcttttgattcgagatcgg 20499965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 12129228 - 12129264
Alignment:
205 agtctggtggaccgatcacttttgattcgagatcggg 241  Q
    |||||| ||| ||||||||||||||||||||||||||    
12129228 agtctgatggtccgatcacttttgattcgagatcggg 12129264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 185 - 273
Target Start/End: Original strand, 21264977 - 21265065
Alignment:
185 gcctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttggg 273  Q
    |||| |||||||||| || ||| || |||| |||||  |||||||||||||||||||||| || | | ||| ||||||| | |||||||    
21264977 gccttatgatttggtcctgaagactagtgggccgatagcttttgattcgagatcgggagttagttatctggttcaagtttggttttggg 21265065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0200 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: scaffold0200
Description:

Target: scaffold0200; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 191 - 322
Target Start/End: Original strand, 19380 - 19509
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctct 290  Q
    ||||||||| |||||||||||||| ||||||||||||||||||||||||| |||||| ||||||||||||||| | ||||||| |||  || ||   |||    
19380 tgatttggtcctaaagtctggtgggccgatcacttttgattcgagatcggaagtcagttctttggctcaagtttggttttgggcttt--ttatggtttct 19477  T
291 ttcggtggatcagaggtcgagaggttgtggaa 322  Q
    ||||||||||| ||||||||||| | ||||||    
19478 ttcggtggatcggaggtcgagagttggtggaa 19509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 191 - 322
Target Start/End: Complemental strand, 42222 - 42093
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctct 290  Q
    |||||| || |||||||||||||| ||||||||||||||||||||||||| |||||| ||||||||||||||| | |||||||||||  || ||   |||    
42222 tgatttagtcctaaagtctggtgggccgatcacttttgattcgagatcggaagtcagttctttggctcaagtttggttttgggattt--ttatggtttct 42125  T
291 ttcggtggatcagaggtcgagaggttgtggaa 322  Q
    ||| ||||||| ||||||||||| | ||||||    
42124 ttcagtggatcggaggtcgagagttggtggaa 42093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 158 - 260
Target Start/End: Original strand, 36670 - 36773
Alignment:
158 ttctctggtgtaccgggggcgaggggtgcc-tgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggc 256  Q
    ||||||||||||||| | | |||||||||| |  ||||||||| ||||||||||| || | |||||||||||||||||||||||||||||| |||||| |    
36670 ttctctggtgtaccgagagtgaggggtgcccttctgatttggtcctaaagtctggcgggctgatcacttttgattcgagatcgggagtcagttctttgtc 36769  T
257 tcaa 260  Q
    ||||    
36770 tcaa 36773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1613 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold1613
Description:

Target: scaffold1613; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 178 - 255
Target Start/End: Complemental strand, 1114 - 1037
Alignment:
178 gaggggtgcctgatgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttgg 255  Q
    ||||||| |||  |||||||||  | ||||||||||| |||||| ||||||||||||||||||||||||| |||||||    
1114 gaggggtcccttctgatttggtcatgaagtctggtgggccgatcgcttttgattcgagatcgggagtcagttctttgg 1037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0343 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0343
Description:

Target: scaffold0343; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 236 - 309
Target Start/End: Original strand, 5747 - 5820
Alignment:
236 atcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtggatcagaggtcg 309  Q
    |||||||||||| |||||| |||| ||||||||||||| |||  ||||||||||||||||| |||| |||||||    
5747 atcgggagtcagttctttgactcaggttggtttttgggctttgtttttgtgctctttcggtagatcggaggtcg 5820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0063 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0063
Description:

Target: scaffold0063; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 192 - 313
Target Start/End: Original strand, 58125 - 58244
Alignment:
192 gatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctt 291  Q
    |||||||| ||||||| |||||| ||||||||||||||||| ||||||| |||||  | ||||| ||||||| | |||| || |||  || ||   ||||    
58125 gatttggtcctaaagtttggtgggccgatcacttttgattcaagatcggaagtcaattgtttggatcaagtttggttttaggcttt--ttatggtttctt 58222  T
292 tcggtggatcagaggtcgagag 313  Q
    |||||||||| |||||||||||    
58223 tcggtggatcggaggtcgagag 58244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0620 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0620
Description:

Target: scaffold0620; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 191 - 247
Target Start/End: Original strand, 3827 - 3883
Alignment:
191 tgatttggttctaaagtctggtggaccgatcacttttgattcgagatcgggagtcag 247  Q
    ||||||| || || |||||||||| ||||||| ||||||||||||||||||||||||    
3827 tgatttgtttttagagtctggtgggccgatcaattttgattcgagatcgggagtcag 3883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0499 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0499
Description:

Target: scaffold0499; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 204 - 298
Target Start/End: Original strand, 6568 - 6660
Alignment:
204 aagtctggtggaccgatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggattttgttttgtgctctttcggtgg 298  Q
    |||||||||| | ||||| |||||||||| |||| || ||| || ||||||||||||||| | |||| || |||  ||||||| |||||||||||    
6568 aagtctggtgcaacgatctcttttgattcaagattggtagttagttctttggctcaagtttggtttttggcttt--ttttgtgttctttcggtgg 6660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University