View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7429_low_13 (Length: 406)
Name: NF7429_low_13
Description: NF7429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7429_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 383; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 1 - 387
Target Start/End: Complemental strand, 9629747 - 9629361
Alignment:
| Q |
1 |
aatcagtgaggtgtggatgtgatgctaaaatgtatctgtctaaggaggttgttgatggggtttcacagtggactgttctgcagtttagtaatgtgcataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9629747 |
aatcagtgaggtgtggatgtgatgctaaaatgtatctgtctaaggatgttgttgatggggtttcacagtggactgttctgcagtttagtaatgtgcataa |
9629648 |
T |
 |
| Q |
101 |
tcatgagcttttggaagatgatcaagtgcgtcttttacctgcttatcggaagattcatgaggctgatcaagagcgtatactcttgctttcaaaagctggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9629647 |
tcatgagcttttggaagatgatcaagtgcgtcttttacctgcttatcggaagattcatgaggctgatcaagagcgtatactcttgctttcaaaagctggg |
9629548 |
T |
 |
| Q |
201 |
tttccggtacaccggatagtgaaaatgcttgagcttgaaaagggaattcaaggtggacatttgtctttcttggaaagggatgtgaggaactttgtgcaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9629547 |
tttccggtacaccggatagtgaaaatgcttgagcttgaaaagggaattcaaggtggacatttgtctttcttggaaagggatgtgaggaactttgtgcaaa |
9629448 |
T |
 |
| Q |
301 |
atcgaaagaaggttattcaggagaatgaggcattgcttaatgagaaaagggaaaatgatgttttggaacttcttgaggtgtgcaaag |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9629447 |
atcgaaagaaggttattcaggagaatgaggcattgcttaatgagaaaagggaaaatgatgttttggaacttcttgaggtgtgcaaag |
9629361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University