View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7429_low_9 (Length: 440)
Name: NF7429_low_9
Description: NF7429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7429_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 17 - 424
Target Start/End: Complemental strand, 528655 - 528248
Alignment:
| Q |
17 |
acatcaatgactcaccacatccatgaggatatctacaagatcaggagcattaatcatgaccaccacggattcttttgaaccctcaagccttaatccacat |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
528655 |
acattaatgactcaccacatccatgaggatatctacaagatcaggagcattaatcatgaccaccacggattcttttgaaccctcaagccttaatccacat |
528556 |
T |
 |
| Q |
117 |
gtgttgggaccattaccccttgggaaatacttcatgtattcctctccattgagaatctcagtcacatagttggtggggatccaaagagggggtccatatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
528555 |
gtgttgggaccattaccccttgggaaatacttcatgtattcctctccattgagaatctcagtcacatagttggtggggatccaaagagggggtccatatg |
528456 |
T |
 |
| Q |
217 |
tcctagccaatttggtcagttcatccattccaacaacagcaagctctacaatcttttgcttctcattaagacccttaatctgcactgaggagccaccaac |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
528455 |
tcctagccaatttggtcagttcatccattccaacaacagcaagctctacaatcttttgcttctcattaagacccttaatctgcactgaggagccaccaac |
528356 |
T |
 |
| Q |
317 |
gcttaaaccctcttctaccatgcggtggcttgctccattgttaccaccggcaactccaaaatcagtagagcgtgaagcaacatgagtgctattgttggat |
416 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
528355 |
gcttaaaccctctcctaccatgcggtggcttgctccattgttaccaccggcaactccaaaatccgtagagtgtgaagcaacatgagtgctattgttggat |
528256 |
T |
 |
| Q |
417 |
gatgttat |
424 |
Q |
| |
|
|||||||| |
|
|
| T |
528255 |
gatgttat |
528248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University