View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7430_high_8 (Length: 253)
Name: NF7430_high_8
Description: NF7430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7430_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 95 - 205
Target Start/End: Original strand, 34551586 - 34551696
Alignment:
| Q |
95 |
aatatacaacactaaaatttaagtttatgctcaacattacaatacttccacatcaattcacgatgagaaatgttttttaatttactcttaatagaacaaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34551586 |
aatatacaacactaaaatttaagtttatgctcaacattacaatacttccacatccgttcaggatgagaaatgttttttgatttactcttaatagaacaaa |
34551685 |
T |
|
| Q |
195 |
caaaaacgaaa |
205 |
Q |
| |
|
||||||||||| |
|
|
| T |
34551686 |
caaaaacgaaa |
34551696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University