View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7430_low_12 (Length: 246)
Name: NF7430_low_12
Description: NF7430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7430_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 83 - 207
Target Start/End: Original strand, 25882679 - 25882803
Alignment:
| Q |
83 |
aacataacgtttgggagttatgagccgaacaaattcgggagataacttcttttcggtatgttttggcgggaatggtcctttttatataccagaatagtat |
182 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25882679 |
aacataacgtttgggagttatgaaccgaagaaattcgggagataacttcttttcggtatgttttggcgggaatggtcctttttatataccagaatagtat |
25882778 |
T |
|
| Q |
183 |
atatacgaggtttgaaacttgtgaa |
207 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
25882779 |
atatacgaggtttgaaacttgtgaa |
25882803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 10 - 56
Target Start/End: Original strand, 25882593 - 25882639
Alignment:
| Q |
10 |
aagaatatcacattgaaagtatgttatccatccatatataactgctt |
56 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
25882593 |
aagaaaatcacattgaaattatgttatccatccatacataactgctt |
25882639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University