View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7432_high_9 (Length: 281)
Name: NF7432_high_9
Description: NF7432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7432_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 22 - 275
Target Start/End: Complemental strand, 7676886 - 7676634
Alignment:
| Q |
22 |
gtacatgctaaaatttctagcacggtttaatcgtataatgaaaacnnnnnnngtttagattgattgggtctcagagactcnnnnnnnntcaaagagtgtt |
121 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| || |||| ||||||| |
|
|
| T |
7676886 |
gtacatgctaaa-tttctagcacggtttaatcgtataatgaaaacaaaaaaagtttagattgattgtgtctcggagaatcaaaaaaaatcaaggagtgtt |
7676788 |
T |
|
| Q |
122 |
gacacatatattttacgaacgtagttcatacattgacaacaaaattcaaacctagatttttgtcggatttagagtgcaacctaggggggtgaattaggtt |
221 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7676787 |
gacacatatatcttacgaacgtagttcatacattgacaacaaaattcaaacctagatttttgtcggatatagagtgcaacctaggggggtgaattaggtt |
7676688 |
T |
|
| Q |
222 |
taaagactttttcggtgtttttatagattttaaggttctttttatattcttcga |
275 |
Q |
| |
|
| ||||||||||| ||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
7676687 |
ttaagactttttcagtgtttttatagattttaaggttctttttatttttttcga |
7676634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University