View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7432_low_10 (Length: 296)
Name: NF7432_low_10
Description: NF7432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7432_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 9 - 279
Target Start/End: Complemental strand, 9574638 - 9574368
Alignment:
| Q |
9 |
gaagaatatgtctagtaagtgactgattaaagaatcttaaccctcaatttttaaatggacaatttggctttttataaattgtccatagttgcagacttag |
108 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9574638 |
gaagaaaatgtctagtaagtgattgattaaagaatcttaaccctcaatttttaaatggacaatttagctttttataaattgtccatagttgcagacttag |
9574539 |
T |
|
| Q |
109 |
gacaatgattctagaagacacgaggagatgatgaccatttaccacaagaagtcataccaatcgtctcatatctttcctcccagcttgtttgcaagggttg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9574538 |
gacaatgattctagaagacacgaggagatgatggccatttaccacaagaagtcataccaatcgtctcatatctttcctcccagctcgtttgcaagggtta |
9574439 |
T |
|
| Q |
209 |
cccgcaatcgaggctaagtgggacaaaatgttcttgactccactacattttgaagtattgacccttggatt |
279 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9574438 |
cccgcaatcgaggctaagtgagacaaaatgttcttgactccactacattttgaagtattgacccttggatt |
9574368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 79 - 120
Target Start/End: Original strand, 9579172 - 9579213
Alignment:
| Q |
79 |
tttataaattgtccatagttgcagacttaggacaatgattct |
120 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||| |||||| |
|
|
| T |
9579172 |
tttataaactgtccatagttgcagacttagtacaacgattct |
9579213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University