View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7432_low_8 (Length: 328)
Name: NF7432_low_8
Description: NF7432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7432_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 42669568 - 42669251
Alignment:
| Q |
1 |
gattcagaccggcttccgtctaaactctaatattaatctctcgagtcagataagactacaatcagttcaaagctttgttctccttttcctcttttgattc |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42669568 |
gattcagaccagcttccgtctaaactctaatattaatctctcgagtcagataagactgcaatcagttcaaagctttgttctcctttccctcttttgattc |
42669469 |
T |
|
| Q |
101 |
tcttaacatatctttgtttaggaaaaaataactcgatcaatattttagttaattaattaacaag--------nnnnnnnnnggtttggattgtgatgtac |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42669468 |
tcttaacatatctttgtttaggaaaaaataactcgatcaatatt----ttaattaattaacaagtttttttttttttttttggtttggattgtgatgtac |
42669373 |
T |
|
| Q |
193 |
tggacccatatggtttgtgtgaaataattagttaattaattgattgggtgattgagttagttacttataagtgccgtgttgtatatgtaaacgtttcatc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42669372 |
tggacccatatggtttgtgtgaaataattagttaattaattaattgggtgattgagttagttacttataagtgccgtgttgtatatgtaaacgtttcatc |
42669273 |
T |
|
| Q |
293 |
ttaatttggttcattttgatat |
314 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42669272 |
ttaatttggttcattttgatat |
42669251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University