View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7433_high_10 (Length: 281)
Name: NF7433_high_10
Description: NF7433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7433_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 19 - 186
Target Start/End: Complemental strand, 4309152 - 4308985
Alignment:
| Q |
19 |
aggttacctattggtgcaaagagtcttgttagtcatgaatggtggattcctaaaggtgtttatatgaatggtcgtgctatcgaaatgactagcattttgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4309152 |
aggttacctattggtgcaaagagtcttgttagtcatgaatggtggattcctaaaggtgtttatatgaatggtcgtgctatcgaaatgactagcattttgg |
4309053 |
T |
 |
| Q |
119 |
gtccnnnnnnncatgttagtgctcttcctgatcaaaacttcttcaagagttcgccggatattgggtga |
186 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4309052 |
gtcctttttttcatgttagtgctcttcctgatcaaaacttcttcaagagttcgccggatattgggtga |
4308985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University