View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7433_high_13 (Length: 239)
Name: NF7433_high_13
Description: NF7433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7433_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 34402659 - 34402437
Alignment:
| Q |
1 |
tgttttagcatgaatgttgttgcttacttgctttcattgcataattgttgtctgtccaatgtttgtttgcaatgataagtatatgtttgattttgcggca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34402659 |
tgttttagcatgaatgttgttgcttacttgctttcattgcataattgttgtctgtccaatgtttgtttgcaatgataagtatatgtttgattttgcggca |
34402560 |
T |
 |
| Q |
101 |
cgttcaacaaaaccacacttagtttaggagctttgatgaatcaaagtggaaatagtctacgacgcaagtttgaagactctaacgcgaaaccaaacatata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34402559 |
cgttcaacaaaaccacacttagtttaggagctttgatgaatcaaagtggaaatagtctatgacgcaagtttgaagactctaacgcgaaaccaaacatata |
34402460 |
T |
 |
| Q |
201 |
ctatgtttgttcttgtagtaaat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34402459 |
ctatgtttgttcttgtagtaaat |
34402437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 191 - 223
Target Start/End: Complemental strand, 34402434 - 34402402
Alignment:
| Q |
191 |
caaacatatactatgtttgttcttgtagtaaat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34402434 |
caaacatatactatgtttgttcttgtagtaaat |
34402402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University