View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7433_high_6 (Length: 458)
Name: NF7433_high_6
Description: NF7433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7433_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 359; Significance: 0; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 1 - 451
Target Start/End: Original strand, 3018041 - 3018492
Alignment:
| Q |
1 |
tttctagtgaagaccaaacttcatatatgtatgttt----atagatattgccaaatttctttgcttgattattctaaaaggtaagtttcatatgcaattc |
96 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3018041 |
tttctagttaagaccaaacttcatatatgtatgtttgtttatagatattgccaaatttctttgcttgattattctaaaaggtaagtttcatatgcaattc |
3018140 |
T |
 |
| Q |
97 |
atctagataatattctaattacatcctatggtgactttataagcaaaggaatcattttttaggttcattgtttaacggatgtgtctagtctataccatta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3018141 |
atctagataatattctaattacatcctatggtgactttataagcaaagaaatcattttttaggttcattgtttaacggatgtgtctagtctataccgtta |
3018240 |
T |
 |
| Q |
197 |
ttcagggaacattnnnnnnnnttgtttataataatggatgggtacattacaacgatgtatcagccccaccgccagacgtgtccatttgagtgaatcaatc |
296 |
Q |
| |
|
|| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3018241 |
tttagggaacattaaaaaaaattgtttataataatggatgggtacattacaacgatgtatcagccccaccgc-agacgtgtccatttgagtgaatcaatc |
3018339 |
T |
 |
| Q |
297 |
tttcttttagatggcttggatacatacctcatagggttcgatacatgtcaaagcgggtgtttcaccagtttggttacgtccagaccatcccaagccatcc |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3018340 |
tttcttttagatggcttggatacatacctcatagggttcgatacatgtcaaagcgggtgttgcgccagtttggttacgtccagaccatcccaagccatcc |
3018439 |
T |
 |
| Q |
397 |
acataagagtgcaaatcccaaggtgaacacaactagcgcaatatcttgatgatgt |
451 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||| |||| |
|
|
| T |
3018440 |
acataagagtgcaaatcccaaggtga--acaactagcataatatcttgattatgt |
3018492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 10 - 91
Target Start/End: Original strand, 3021169 - 3021251
Alignment:
| Q |
10 |
aagaccaaacttcatatatgtatgtttata--gatattgccaaatttctttgcttgattattctaaaaggtaagtttcatatgc |
91 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||| ||||| ||||| |||||||||||||||||| ||||||| |
|
|
| T |
3021169 |
aagaccaaacttcatat-tgtatgtttatacagatattgccaaaagtcttttcttgactattctaaaaggtaagttgcatatgc |
3021251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 252 - 309
Target Start/End: Complemental strand, 24141722 - 24141665
Alignment:
| Q |
252 |
tgtatcagccccaccgccagacgtgtccatttgagtgaatcaatctttcttttagatg |
309 |
Q |
| |
|
|||||||||||||||||||||| ||||| || ||| |||||| ||||| |||| |||| |
|
|
| T |
24141722 |
tgtatcagccccaccgccagacatgtccgttcgagcgaatcagtctttattttggatg |
24141665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University