View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7433_high_8 (Length: 375)
Name: NF7433_high_8
Description: NF7433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7433_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 244
Target Start/End: Complemental strand, 2794907 - 2794670
Alignment:
| Q |
7 |
tcgaagaaaataaattttgtttcccttacctataaataaagttttcataacacatttaattttgattttcgaaaaattgaacactgaccaatggataagt |
106 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2794907 |
tcgaagcaaagaaattttgtttcccttacctataaataaagttttcataacacagttaattttgattttcgaaaaattggacactgaccaatggataagt |
2794808 |
T |
|
| Q |
107 |
tattttggttgaattaaaacatggaaagtaggaaacttgtccccatatccgtatcatcctaatctgcatataaaagaaagggatagaaccacaatataaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2794807 |
tattttggttgaattaaaacatggaaagtaggaaacttgtccccatatccgtatcatcctaatctgcatataaaagaaagggatagaaccacaatataaa |
2794708 |
T |
|
| Q |
207 |
aatgggtgataaatgtctatgtgagattagttcagttg |
244 |
Q |
| |
|
|||||||||||||||| || ||||| ||| ||||||| |
|
|
| T |
2794707 |
aatgggtgataaatgtatacgtgagcttatatcagttg |
2794670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 323 - 357
Target Start/End: Complemental strand, 2794593 - 2794559
Alignment:
| Q |
323 |
ccctgtcaccatgcaccattggatggccaaccact |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2794593 |
ccctgtcaccatgcaccattggatggccaaccact |
2794559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University