View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7433_low_11 (Length: 307)
Name: NF7433_low_11
Description: NF7433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7433_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 30 - 156
Target Start/End: Original strand, 37797919 - 37798045
Alignment:
| Q |
30 |
catgtttaacccgtagttaattcgtagagagactaatttaattcctatatgcaatttcattaaggtccttccgtataccacctgattttctctcaagttt |
129 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
37797919 |
catgtttaacccatagttaattcatagagagactaatttaattcctatatgcaatttcattaaggtccttccttataccacctgattttctctcgagttt |
37798018 |
T |
 |
| Q |
130 |
ttgcatatagaactcttcgctcgtttt |
156 |
Q |
| |
|
| ||||||||||||||||||||||||| |
|
|
| T |
37798019 |
tcgcatatagaactcttcgctcgtttt |
37798045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University