View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7433_low_12 (Length: 301)
Name: NF7433_low_12
Description: NF7433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7433_low_12 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 12 - 301
Target Start/End: Original strand, 179448 - 179737
Alignment:
| Q |
12 |
atggacatcacagacatggcggtttatttagattctctcctttcaattaatctcatcaataccaccagctcaaagttccatattcatgtagcccttatcc |
111 |
Q |
| |
|
|||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
179448 |
atgggcatcacagatatggcggtttattcagattctctcctttcaattaatctcatcactaccaccagttcaaagttccatattcatgcggccctaatcc |
179547 |
T |
 |
| Q |
112 |
aagacatcagagacaagctttctctaaagaatttttcgctcaaccacaccctccgggaaggaaatcaaagtgctgactatttggctaaactaggtgcaat |
211 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
179548 |
aagatatcagagacaagctttctctaaggaatttttcgctcaaccacaccctccgggaaggaaatcaaagtgctgactatttggctaaactaggtgcaat |
179647 |
T |
 |
| Q |
212 |
gtcagatatcaacgtcctaatacaccagttgcctccggatgagctacgccctttgttgaagattgatgcagcaggaaccttgtttctgag |
301 |
Q |
| |
|
||||||| ||||||| ||||||||||||| |||||||||||| || ||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
179648 |
gtcagatgtcaacgttctaatacaccagtcgcctccggatgaactctgccctttgttgaagaatgatgcagcaggaaccttgttcctgag |
179737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 12 - 69
Target Start/End: Complemental strand, 45440057 - 45440000
Alignment:
| Q |
12 |
atggacatcacagacatggcggtttatttagattctctcctttcaattaatctcatca |
69 |
Q |
| |
|
|||| |||| |||| |||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
45440057 |
atgggcatctcagatatggttgtttatttagattccctcctttcaattaacctcatca |
45440000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University