View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7433_low_14 (Length: 272)
Name: NF7433_low_14
Description: NF7433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7433_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 5e-31; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 50886622 - 50886523
Alignment:
| Q |
15 |
tattttgcttgctttcaggtctctgtgaactagattattcnnnnnnnntaaaagtatacgtgaactagagtttgaccaaattcattgtgtgtgtaattaa |
114 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50886622 |
tattttgcttgctttcaagtctctgtgaactagattattcaaaaaa--taaaagtatacgtgaactagagtttgaccaaattcattgtgtgtgtaattaa |
50886525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 109 - 164
Target Start/End: Complemental strand, 50886365 - 50886310
Alignment:
| Q |
109 |
aattaaatttaaaaaacaaagtaaaatattttatatagtttattaaactaatggtt |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50886365 |
aattaaatttaaaaaacaaagtaaaatattttatatagtttattaaactaatggtt |
50886310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 242
Target Start/End: Complemental strand, 50886288 - 50886243
Alignment:
| Q |
193 |
aatccaatttactaatggttttaaacatcagatttaatgttgccaccatg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
50886288 |
aatccaatttactaatggttttaaacat----tttaatgttggcaccatg |
50886243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University