View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7433_low_18 (Length: 238)
Name: NF7433_low_18
Description: NF7433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7433_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 224
Target Start/End: Complemental strand, 14209521 - 14209314
Alignment:
| Q |
17 |
acttttggcatgtatgtgcatgtataattatgcctcagggaaaggtattgtccttgtcagtttttcttgttttatgaggcttgtccttacctcagttatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14209521 |
acttttggcatgtatgtgcatgtataattatgcctcagggaaaggtattgtccttgtcagtttttcttgttttatgaggcttgtccttacctcagttatg |
14209422 |
T |
|
| Q |
117 |
ttacttaacaaatgtcacgacaatggcaattcatctaaattgaactcaacaaattcagcacttgggttctgtttggattggtttatttgagtttatttac |
216 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14209421 |
ttacttaaaaaatgtcacgacaatggcaattcatctaaattgaactcaacaaattcagcacttaggttctgtttggattggtttatttgagtttatttac |
14209322 |
T |
|
| Q |
217 |
tagtataa |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
14209321 |
tagtataa |
14209314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 219
Target Start/End: Complemental strand, 26717378 - 26717345
Alignment:
| Q |
186 |
tgtttggattggtttatttgagtttatttactag |
219 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
26717378 |
tgtttggattggtttatttgagtttatctactag |
26717345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 216
Target Start/End: Original strand, 36643794 - 36643826
Alignment:
| Q |
184 |
tctgtttggattggtttatttgagtttatttac |
216 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
36643794 |
tctgtttggattggtttatttgagcttatttac |
36643826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 217
Target Start/End: Complemental strand, 25719824 - 25719791
Alignment:
| Q |
184 |
tctgtttggattggtttatttgagtttatttact |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
25719824 |
tctgtttggattgatttatttgagtttatttact |
25719791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 212
Target Start/End: Complemental strand, 7941759 - 7941731
Alignment:
| Q |
184 |
tctgtttggattggtttatttgagtttat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7941759 |
tctgtttggattggtttatttgagtttat |
7941731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University