View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7438_high_9 (Length: 235)
Name: NF7438_high_9
Description: NF7438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7438_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 40 - 219
Target Start/End: Original strand, 12312532 - 12312708
Alignment:
| Q |
40 |
acaatgctcaaaggttggatatattaatttggattcaaactcaagatcttccggtgtatgagtttcaataatgtttactacttgttacatgatttttgaa |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
12312532 |
acaatgctcaaaggttggatatattaatttggattcaaattcaagatcttccggtgtatgagtttcaacaatgtttactactt---acgtgatttttgaa |
12312628 |
T |
 |
| Q |
140 |
tgaaaattttaacaatatgattttatatgttagtaaaatttaaattgatctcattactaatttaaaaatgacctactaaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
12312629 |
tgaaaattttaacaatatgattttatatgttagtgaaatttaaattgatctcattactaatttaaaaacgacccactaaa |
12312708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University