View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7438_low_1 (Length: 581)
Name: NF7438_low_1
Description: NF7438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7438_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 505; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 505; E-Value: 0
Query Start/End: Original strand, 18 - 570
Target Start/End: Original strand, 28674932 - 28675484
Alignment:
| Q |
18 |
tgaagaaggtttatggtggtgttaagtataagccnnnnnnnnnnnnaggtcatagagattctgttgtaggttcgtttttcggcgttgattcgaaaactag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28674932 |
tgaagaaggtttatggtggtgttaagtataagccttttttgtttttaggtcatagagattctgttgtaggttcgtttttcggtgttgattcgaaaactag |
28675031 |
T |
|
| Q |
118 |
taaggtttctaaggtttatactgttactagagattgttatattttaagctggggttttactgaggatgaagaattgtctgagcctccatcgccggggaca |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675032 |
taaggtttctaaggtttatactgttaccagagattgttatattttaagctggggttttactgaggatgaagaattgtctgagcctccatcgccggggaca |
28675131 |
T |
|
| Q |
218 |
ccggatagggatgtcgaaggggatttgatggttgaggatgatggtgatgtgaagaagaggaaggagcgtgaatttgaggatggagggtatttatgtaaag |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675132 |
ccggatagggatgtcgaaggggatttgatggttgaggatgatggtgatgtgaagaagaggaaggagcgtgaatttgaggatggagggtatttatgtaaag |
28675231 |
T |
|
| Q |
318 |
ggaaatgggagttgttgaggaaggattgttttaatcaggctccggcgaaggtttcagcttgtgattatcatagagggttggatatggtggttgttggatt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675232 |
ggaaatgggagttgttgaggaaggattgttttaatcaggctccggcgaaggtttcagcttgtgattatcatagagggttggatatggtggttgttggatt |
28675331 |
T |
|
| Q |
418 |
ttctaatggggtttttgggttgtatcagatgccggatttcgtgtgtattcatttgttgtcgatatcgaaggcgaagattactactgctatgtttaatgat |
517 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675332 |
ttctaatggggtttttgggttgtatcagatgccggatttcgtgtgtattcatttgttgtcgatatcgaaggcgaagattactactgctatgtttaatgat |
28675431 |
T |
|
| Q |
518 |
cttgggaattggttgtcctttggctgtgctaaacttggccagcttcgtgtgtg |
570 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28675432 |
cttgggaattggttgtcctttggctgtgctaaacttggccagcttcttgtgtg |
28675484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University