View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7438_low_11 (Length: 210)

Name: NF7438_low_11
Description: NF7438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7438_low_11
NF7438_low_11
[»] chr8 (1 HSPs)
chr8 (18-196)||(33303090-33303268)


Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 33303090 - 33303268
Alignment:
18 catttatgccattattacgatatggcatgggaagttatgcgatatctatcccttcattacaccctcatatcatattgaccactaaataattactatttta 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33303090 catttatgccattattacgatatggcatgggaagttatgcgatatctatcccttcattacaccctcatatcatattgaccactaaataattactatttta 33303189  T
118 cgatatacgtataggagatgaataatttgattcttaaaatcaagatataaatatggaatttgtctttctttttattgat 196  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33303190 cgatatacgtataggagattaataatttgattcttaaaatcaagatataaatatggaatttgtctttctttttattgat 33303268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University