View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7439_high_21 (Length: 241)
Name: NF7439_high_21
Description: NF7439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7439_high_21 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 53 - 241
Target Start/End: Complemental strand, 11038515 - 11038329
Alignment:
| Q |
53 |
taattagcatttaaacaaatgtgcttaatttattataattgtagaaaatgctctacaaatgtgcttgtgtaaaccatttattcatttgttttgtggaacc |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11038515 |
taattagcatttaaacaaatgtgcttaatttat---aattgtagaaaatgctctacaaatgtgcttgtgtaaaccatttattcatttgttttgtggaacc |
11038419 |
T |
 |
| Q |
153 |
-tcgaaatgaagatgcaatcactctttttctacaattgtattgacatgttttgtgattcatgttgaccattggaggacaggtacctgtac |
241 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11038418 |
ctcgaaatgaaaatgcaatcactctttttctacaattgtattgacatgttttgtgattcatgttgaccattggtggacaggtacctgtac |
11038329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University