View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7439_high_8 (Length: 393)
Name: NF7439_high_8
Description: NF7439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7439_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 109 - 374
Target Start/End: Original strand, 11038079 - 11038344
Alignment:
| Q |
109 |
tcaatgatattgaactaaattttataataaaaatgattgcatgtcacaagacggagcatatagttgcatgtgacaattgagggaagttattattgttatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11038079 |
tcaatgatattgaactaaattttataataaaaatgattgcatgtgacaagacggagcatatagttgcatgtgacaattgagggaagttattattgttatc |
11038178 |
T |
 |
| Q |
209 |
atgtaaagccatgtgatgcagtcatgtgatgctggatctttctatgtcaatgtcagatcttcttgtatcagtaggatcctgactttgccaactacttttt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11038179 |
atgtaaagccatgtgatgcagtcatgtgatgctggatctttctatgtcaatgtcagatcttcttgtatcagtaggatcctgactttgccaactactcttt |
11038278 |
T |
 |
| Q |
309 |
gtccttccatttaaaacaataataactaaccacgcatccaatctagcaaagtacaggtacctgtcc |
374 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11038279 |
gtcctttcatttaaaacaacaataactaaccacgcatccaatctagcaaagtacaggtacctgtcc |
11038344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 81
Target Start/End: Original strand, 11037986 - 11038057
Alignment:
| Q |
7 |
tttggagtttgaaccccttgcatctttactaattcacttttaagttgaatttctccagccgctatgctaatcgac |
81 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||| |||||||||||||||||| | ||||||||||||||| |
|
|
| T |
11037986 |
tttggagtttaaaccccttacatgcttactaattc---tttaagttgaatttctccgactgctatgctaatcgac |
11038057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University